\
| Variant ID: vg0225995471 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25995471 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 103. )
TATTTGTAGTAGTAAAAGTGTGTATTTAGTTCACGCTAAAATTAGAAGTTTAAGTGAAATTGAAACGATGTGACGGAAAAGTTGGAAGTTTGTATGTGTA[G/A]
AAAAGTTTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAAGAGAAAATTCCCTATATACCCCTGAAAATTTACTCAATCCCTTCAATACCCCTGAATTT
AAATTCAGGGGTATTGAAGGGATTGAGTAAATTTTCAGGGGTATATAGGGAATTTTCTCTTTCTTCAAACTTTCAACTTTTCCATCACATCAAAACTTTT[C/T]
TACACATACAAACTTCCAACTTTTCCGTCACATCGTTTCAATTTCACTTAAACTTCTAATTTTAGCGTGAACTAAATACACACTTTTACTACTACAAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 45.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 80.40% | 19.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.40% | 24.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 70.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225995471 | G -> A | LOC_Os02g43150.1 | upstream_gene_variant ; 1443.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 | N | N | N | N |
| vg0225995471 | G -> A | LOC_Os02g43150.2 | upstream_gene_variant ; 1443.0bp to feature; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 | N | N | N | N |
| vg0225995471 | G -> A | LOC_Os02g43140-LOC_Os02g43150 | intergenic_region ; MODIFIER | silent_mutation | Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225995471 | NA | 4.41E-12 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 2.54E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 5.51E-32 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 6.06E-29 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 3.40E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.12E-12 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.81E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 2.65E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 3.44E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 4.13E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.26E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 9.58E-13 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 9.23E-43 | mr1072_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.17E-43 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 6.89E-08 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 4.85E-26 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 4.57E-08 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 8.31E-31 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 5.99E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 7.90E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.59E-32 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 7.09E-19 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 3.26E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225995471 | NA | 1.50E-47 | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |