\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225995471:

Variant ID: vg0225995471 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25995471
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTGTAGTAGTAAAAGTGTGTATTTAGTTCACGCTAAAATTAGAAGTTTAAGTGAAATTGAAACGATGTGACGGAAAAGTTGGAAGTTTGTATGTGTA[G/A]
AAAAGTTTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAAGAGAAAATTCCCTATATACCCCTGAAAATTTACTCAATCCCTTCAATACCCCTGAATTT

Reverse complement sequence

AAATTCAGGGGTATTGAAGGGATTGAGTAAATTTTCAGGGGTATATAGGGAATTTTCTCTTTCTTCAAACTTTCAACTTTTCCATCACATCAAAACTTTT[C/T]
TACACATACAAACTTCCAACTTTTCCGTCACATCGTTTCAATTTCACTTAAACTTCTAATTTTAGCGTGAACTAAATACACACTTTTACTACTACAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.90% 0.13% 0.00% NA
All Indica  2759 80.40% 19.40% 0.18% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 66.50% 33.50% 0.00% 0.00% NA
Indica III  913 80.90% 19.10% 0.00% 0.00% NA
Indica Intermediate  786 75.40% 24.20% 0.38% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 94.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 28.90% 70.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225995471 G -> A LOC_Os02g43150.1 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 N N N N
vg0225995471 G -> A LOC_Os02g43150.2 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 N N N N
vg0225995471 G -> A LOC_Os02g43140-LOC_Os02g43150 intergenic_region ; MODIFIER silent_mutation Average:53.554; most accessible tissue: Zhenshan97 flower, score: 79.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225995471 NA 4.41E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 2.54E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 5.51E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 6.06E-29 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 3.40E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.12E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.81E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 2.65E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 3.44E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 4.13E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.26E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 9.58E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 9.23E-43 mr1072_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.17E-43 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 6.89E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 4.85E-26 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 4.57E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 8.31E-31 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 5.99E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 7.90E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.59E-32 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 7.09E-19 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 3.26E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225995471 NA 1.50E-47 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251