Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225967380:

Variant ID: vg0225967380 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25967380
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCAATTCATTTATAGCCAATCTAATAGCTCATTCATACAATAGTTACATACTGCACTATTAATACCTAGTCCCACATGTTATAGACACACTGCGTCTT[G/A]
GAGTCTGTGCTACAGCTGGCTATAAATCTGTAGCCCGCTGCTTTTATCTCTCCTGATTTATCTTTTTAAAATAATTTATCTTTTTAAAATATGTTTGTAG

Reverse complement sequence

CTACAAACATATTTTAAAAAGATAAATTATTTTAAAAAGATAAATCAGGAGAGATAAAAGCAGCGGGCTACAGATTTATAGCCAGCTGTAGCACAGACTC[C/T]
AAGACGCAGTGTGTCTATAACATGTGGGACTAGGTATTAATAGTGCAGTATGTAACTATTGTATGAATGAGCTATTAGATTGGCTATAAATGAATTGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.10% 17.20% 6.47% 57.24% NA
All Indica  2759 1.20% 2.10% 8.45% 88.26% NA
All Japonica  1512 49.20% 48.50% 0.00% 2.31% NA
Aus  269 1.50% 0.40% 25.28% 72.86% NA
Indica I  595 0.00% 1.50% 6.89% 91.60% NA
Indica II  465 0.60% 1.10% 6.88% 91.40% NA
Indica III  913 1.10% 0.50% 9.53% 88.83% NA
Indica Intermediate  786 2.40% 5.10% 9.29% 83.21% NA
Temperate Japonica  767 14.90% 84.70% 0.00% 0.39% NA
Tropical Japonica  504 91.10% 3.20% 0.00% 5.75% NA
Japonica Intermediate  241 71.00% 27.80% 0.00% 1.24% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 36.70% 20.00% 5.56% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225967380 G -> A LOC_Os02g43120.1 downstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:81.405; most accessible tissue: Zhenshan97 panicle, score: 98.987 N N N N
vg0225967380 G -> A LOC_Os02g43110-LOC_Os02g43120 intergenic_region ; MODIFIER silent_mutation Average:81.405; most accessible tissue: Zhenshan97 panicle, score: 98.987 N N N N
vg0225967380 G -> DEL N N silent_mutation Average:81.405; most accessible tissue: Zhenshan97 panicle, score: 98.987 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225967380 G A 0.0 0.01 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225967380 NA 1.89E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 1.02E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 8.37E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 7.57E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 3.76E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 1.99E-06 mr1888 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 3.42E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 1.22E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 6.77E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 3.91E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 1.61E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225967380 NA 2.65E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251