Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225928004:

Variant ID: vg0225928004 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25928004
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CACCTTACAATGGAAGCTATTGTAAAGTGGTTTTAGAAACGATAATACTAATTTCTCAGGCGTGGAGACCGCTGGAGTGTTTATTTTTTCAAAATAACTT[T/A]
TTTTAGATAATAATCACACAAAATAACTAAATGTATTTAACTTATTTCCTGTAAGTACTGGTAATTTTGCCACCTACTGTGCTTAAACCAAGCCTGGATA

Reverse complement sequence

TATCCAGGCTTGGTTTAAGCACAGTAGGTGGCAAAATTACCAGTACTTACAGGAAATAAGTTAAATACATTTAGTTATTTTGTGTGATTATTATCTAAAA[A/T]
AAGTTATTTTGAAAAAATAAACACTCCAGCGGTCTCCACGCCTGAGAAATTAGTATTATCGTTTCTAAAACCACTTTACAATAGCTTCCATTGTAAGGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.50%	0.13%	0.00%	NA
All Indica	2759	88.70%	11.20%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	35.30%	63.90%	0.74%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	81.10%	18.70%	0.22%	0.00%	NA
Indica III	913	86.30%	13.60%	0.11%	0.00%	NA
Indica Intermediate	786	87.50%	12.20%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225928004	T -> A	LOC_Os02g43050.1	upstream_gene_variant ; 554.0bp to feature; MODIFIER	silent_mutation	Average:42.877; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0225928004	T -> A	LOC_Os02g43060.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:42.877; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0225928004	T -> A	LOC_Os02g43050-LOC_Os02g43060	intergenic_region ; MODIFIER	silent_mutation	Average:42.877; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225928004	NA	2.83E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	9.98E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	6.48E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	8.43E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	8.39E-07	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	2.58E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	1.37E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	1.00E-06	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	3.06E-06	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	3.60E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	7.08E-06	mr1698_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	3.45E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	1.49E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	4.41E-06	3.38E-08	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	1.33E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	NA	1.34E-07	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	7.04E-06	7.02E-06	mr1919_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225928004	1.47E-07	1.47E-07	mr1919_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251