\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225887862:

Variant ID: vg0225887862 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25887862
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GTATAGTTTGAAAGTATTATCAGTTTAGTTAGTTAGCAAGTCTAAAAATATTAGCAAAAAACATGATATACAAAATTAGTTTGTGATTTATCATCTTTTT[C/T]
AAAGTAAAATAAATGATACTTATTTGTAAGATTATTTAATAGTTTACATTAAAAGAATTTAGCAAAAAAGACTAGTTTCAAACTTTCAATGATATTATTA

Reverse complement sequence

TAATAATATCATTGAAAGTTTGAAACTAGTCTTTTTTGCTAAATTCTTTTAATGTAAACTATTAAATAATCTTACAAATAAGTATCATTTATTTTACTTT[G/A]
AAAAAGATGATAAATCACAAACTAATTTTGTATATCATGTTTTTTGCTAATATTTTTAGACTTGCTAACTAACTAAACTGATAATACTTTCAAACTATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 12.60% 0.57% 0.00% NA
All Indica  2759 77.70% 21.40% 0.94% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.80% 22.50% 2.69% 0.00% NA
Indica II  465 85.80% 13.80% 0.43% 0.00% NA
Indica III  913 71.90% 27.70% 0.44% 0.00% NA
Indica Intermediate  786 81.80% 17.70% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225887862 C -> T LOC_Os02g43000.1 downstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:56.241; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0225887862 C -> T LOC_Os02g43010.1 downstream_gene_variant ; 2579.0bp to feature; MODIFIER silent_mutation Average:56.241; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0225887862 C -> T LOC_Os02g43010.2 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:56.241; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg0225887862 C -> T LOC_Os02g43000-LOC_Os02g43010 intergenic_region ; MODIFIER silent_mutation Average:56.241; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225887862 NA 5.63E-06 mr1021 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 1.15E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 1.06E-07 mr1189 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 8.22E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 3.24E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 5.88E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 1.20E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 5.53E-07 5.13E-09 mr1781 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 3.96E-06 3.96E-06 mr1781 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 1.06E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 6.58E-06 mr1817 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 8.57E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 3.14E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225887862 NA 3.14E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251