\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225864108:

Variant ID: vg0225864108 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25864108
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.10, A: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTCGCCGACGAAACATGCATTATTATTTTTTTCATATCCTAGTTATATACTCCCTCCGTTCCTAAATATTTGACGCCGTTGTTTTTTTAAACATGTTT[G/T,A]
ACCGTTCGTCTTATTTAAAAAAAATTGTGAAATATTTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCGAATGATAGGAAAAGAATTACT

Reverse complement sequence

AGTAATTCTTTTCCTATCATTCGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTAAATATTTCACAATTTTTTTTAAATAAGACGAACGGT[C/A,T]
AAACATGTTTAAAAAAACAACGGCGTCAAATATTTAGGAACGGAGGGAGTATATAACTAGGATATGAAAAAAATAATAATGCATGTTTCGTCGGCGAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.80% 0.13% 0.00% A: 0.15%
All Indica  2759 51.80% 47.90% 0.22% 0.00% A: 0.11%
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 37.20% 61.30% 0.00% 0.00% A: 1.49%
Indica I  595 70.80% 29.10% 0.17% 0.00% NA
Indica II  465 26.00% 74.00% 0.00% 0.00% NA
Indica III  913 57.70% 41.70% 0.33% 0.00% A: 0.22%
Indica Intermediate  786 45.70% 53.90% 0.25% 0.00% A: 0.13%
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225864108 G -> A LOC_Os02g42970.1 upstream_gene_variant ; 3125.0bp to feature; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0225864108 G -> A LOC_Os02g42960.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0225864108 G -> A LOC_Os02g42970-LOC_Os02g42980 intergenic_region ; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0225864108 G -> T LOC_Os02g42970.1 upstream_gene_variant ; 3125.0bp to feature; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0225864108 G -> T LOC_Os02g42960.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0225864108 G -> T LOC_Os02g42970-LOC_Os02g42980 intergenic_region ; MODIFIER silent_mutation Average:46.29; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225864108 NA 7.03E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.17E-08 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 7.22E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.90E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.73E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.92E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.83E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.39E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 7.08E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.09E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 9.95E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 9.37E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 9.18E-07 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 8.30E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 4.29E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.25E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 5.98E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.76E-07 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.16E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.31E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.20E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.49E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 7.31E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 5.87E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 5.28E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 2.01E-06 5.85E-10 mr1962 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.92E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.57E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 9.27E-09 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.01E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 5.43E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.86E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 3.58E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 1.34E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225864108 NA 2.86E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251