\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225847151:

Variant ID: vg0225847151 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25847151
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTACTAACGAGGATGGTACAAGCCGCCACTATCATTTATGAAAGCTTCCTCCTGTCTTATACTCTTACACTGGTGAAGAAGTGCTTTTTAAGTCCCAG[T/C]
TCGTAACCTCCTGTAGTCCCGGTTTTTTAATCGGGACTACGAATCCGGGACTAAAGATCGCTATCTTTAATCCTGGTTCAAATAACCGGGACTAAAGATC

Reverse complement sequence

GATCTTTAGTCCCGGTTATTTGAACCAGGATTAAAGATAGCGATCTTTAGTCCCGGATTCGTAGTCCCGATTAAAAAACCGGGACTACAGGAGGTTACGA[A/G]
CTGGGACTTAAAAAGCACTTCTTCACCAGTGTAAGAGTATAAGACAGGAGGAAGCTTTCATAAATGATAGTGGCGGCTTGTACCATCCTCGTTAGTAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 25.20% 0.47% 3.20% NA
All Indica  2759 92.90% 1.90% 0.14% 5.07% NA
All Japonica  1512 32.50% 66.30% 1.19% 0.00% NA
Aus  269 91.80% 5.20% 0.00% 2.97% NA
Indica I  595 90.30% 0.00% 0.00% 9.75% NA
Indica II  465 94.00% 0.60% 0.00% 5.38% NA
Indica III  913 97.30% 1.50% 0.11% 1.10% NA
Indica Intermediate  786 89.20% 4.50% 0.38% 5.98% NA
Temperate Japonica  767 46.70% 51.20% 2.09% 0.00% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.10% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225847151 T -> DEL N N silent_mutation Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0225847151 T -> C LOC_Os02g42950.1 upstream_gene_variant ; 4422.0bp to feature; MODIFIER silent_mutation Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0225847151 T -> C LOC_Os02g42950-LOC_Os02g42960 intergenic_region ; MODIFIER silent_mutation Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225847151 NA 1.65E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 2.78E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 9.92E-07 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 4.50E-06 NA mr1062_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 4.45E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 5.45E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 1.46E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 4.56E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151 NA 2.06E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251