Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225847151:

Variant ID: vg0225847151 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25847151
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTACTAACGAGGATGGTACAAGCCGCCACTATCATTTATGAAAGCTTCCTCCTGTCTTATACTCTTACACTGGTGAAGAAGTGCTTTTTAAGTCCCAG[T/C]
TCGTAACCTCCTGTAGTCCCGGTTTTTTAATCGGGACTACGAATCCGGGACTAAAGATCGCTATCTTTAATCCTGGTTCAAATAACCGGGACTAAAGATC

Reverse complement sequence

GATCTTTAGTCCCGGTTATTTGAACCAGGATTAAAGATAGCGATCTTTAGTCCCGGATTCGTAGTCCCGATTAAAAAACCGGGACTACAGGAGGTTACGA[A/G]
CTGGGACTTAAAAAGCACTTCTTCACCAGTGTAAGAGTATAAGACAGGAGGAAGCTTTCATAAATGATAGTGGCGGCTTGTACCATCCTCGTTAGTAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	25.20%	0.47%	3.20%	NA
All Indica	2759	92.90%	1.90%	0.14%	5.07%	NA
All Japonica	1512	32.50%	66.30%	1.19%	0.00%	NA
Aus	269	91.80%	5.20%	0.00%	2.97%	NA
Indica I	595	90.30%	0.00%	0.00%	9.75%	NA
Indica II	465	94.00%	0.60%	0.00%	5.38%	NA
Indica III	913	97.30%	1.50%	0.11%	1.10%	NA
Indica Intermediate	786	89.20%	4.50%	0.38%	5.98%	NA
Temperate Japonica	767	46.70%	51.20%	2.09%	0.00%	NA
Tropical Japonica	504	19.80%	80.20%	0.00%	0.00%	NA
Japonica Intermediate	241	14.10%	85.10%	0.83%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	60.00%	36.70%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225847151	T -> DEL	N	N	silent_mutation	Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0225847151	T -> C	LOC_Os02g42950.1	upstream_gene_variant ; 4422.0bp to feature; MODIFIER	silent_mutation	Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0225847151	T -> C	LOC_Os02g42950-LOC_Os02g42960	intergenic_region ; MODIFIER	silent_mutation	Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225847151	NA	1.65E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	2.78E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	9.92E-07	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	4.50E-06	NA	mr1062_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	4.45E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	5.45E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	1.46E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	4.56E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225847151	NA	2.06E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251