\
| Variant ID: vg0225847151 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25847151 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATTACTAACGAGGATGGTACAAGCCGCCACTATCATTTATGAAAGCTTCCTCCTGTCTTATACTCTTACACTGGTGAAGAAGTGCTTTTTAAGTCCCAG[T/C]
TCGTAACCTCCTGTAGTCCCGGTTTTTTAATCGGGACTACGAATCCGGGACTAAAGATCGCTATCTTTAATCCTGGTTCAAATAACCGGGACTAAAGATC
GATCTTTAGTCCCGGTTATTTGAACCAGGATTAAAGATAGCGATCTTTAGTCCCGGATTCGTAGTCCCGATTAAAAAACCGGGACTACAGGAGGTTACGA[A/G]
CTGGGACTTAAAAAGCACTTCTTCACCAGTGTAAGAGTATAAGACAGGAGGAAGCTTTCATAAATGATAGTGGCGGCTTGTACCATCCTCGTTAGTAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 25.20% | 0.47% | 3.20% | NA |
| All Indica | 2759 | 92.90% | 1.90% | 0.14% | 5.07% | NA |
| All Japonica | 1512 | 32.50% | 66.30% | 1.19% | 0.00% | NA |
| Aus | 269 | 91.80% | 5.20% | 0.00% | 2.97% | NA |
| Indica I | 595 | 90.30% | 0.00% | 0.00% | 9.75% | NA |
| Indica II | 465 | 94.00% | 0.60% | 0.00% | 5.38% | NA |
| Indica III | 913 | 97.30% | 1.50% | 0.11% | 1.10% | NA |
| Indica Intermediate | 786 | 89.20% | 4.50% | 0.38% | 5.98% | NA |
| Temperate Japonica | 767 | 46.70% | 51.20% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225847151 | T -> DEL | N | N | silent_mutation | Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0225847151 | T -> C | LOC_Os02g42950.1 | upstream_gene_variant ; 4422.0bp to feature; MODIFIER | silent_mutation | Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0225847151 | T -> C | LOC_Os02g42950-LOC_Os02g42960 | intergenic_region ; MODIFIER | silent_mutation | Average:36.896; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225847151 | NA | 1.65E-10 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 2.78E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | 9.92E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | 4.50E-06 | NA | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 4.45E-18 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 5.45E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 1.46E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 4.56E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225847151 | NA | 2.06E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |