\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225843299:

Variant ID: vg0225843299 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25843299
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTAAAGTATGGCTTGACTTAACTGCGACACGCAAATAAACACTAGCCTGAAAAATTATGGCGCGCCTAAGGTTTGGTGTGGCAAACCGAGGCCACCAA[C/T,A]
CAAACAGCCCGTACCTGTACTGGGTCGTGTTCCTGGGCGCAATGATCAAGAGAGCTCTCGGCTTGCTATGTCGTGCCGTTCGTGGCCGTACGTGTAGAGA

Reverse complement sequence

TCTCTACACGTACGGCCACGAACGGCACGACATAGCAAGCCGAGAGCTCTCTTGATCATTGCGCCCAGGAACACGACCCAGTACAGGTACGGGCTGTTTG[G/A,T]
TTGGTGGCCTCGGTTTGCCACACCAAACCTTAGGCGCGCCATAATTTTTCAGGCTAGTGTTTATTTGCGTGTCGCAGTTAAGTCAAGCCATACTTTACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 9.30% 1.48% 0.00% A: 0.04%
All Indica  2759 98.70% 0.90% 0.25% 0.00% A: 0.07%
All Japonica  1512 75.60% 20.80% 3.64% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.00% A: 0.22%
Indica III  913 98.40% 1.40% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 97.70% 1.50% 0.76% 0.00% NA
Temperate Japonica  767 90.10% 6.80% 3.13% 0.00% NA
Tropical Japonica  504 58.70% 37.10% 4.17% 0.00% NA
Japonica Intermediate  241 64.70% 31.10% 4.15% 0.00% NA
VI/Aromatic  96 12.50% 81.20% 6.25% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225843299 C -> A LOC_Os02g42950.1 upstream_gene_variant ; 570.0bp to feature; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N
vg0225843299 C -> A LOC_Os02g42950.2 upstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N
vg0225843299 C -> A LOC_Os02g42950-LOC_Os02g42960 intergenic_region ; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N
vg0225843299 C -> T LOC_Os02g42950.1 upstream_gene_variant ; 570.0bp to feature; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N
vg0225843299 C -> T LOC_Os02g42950.2 upstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N
vg0225843299 C -> T LOC_Os02g42950-LOC_Os02g42960 intergenic_region ; MODIFIER silent_mutation Average:79.61; most accessible tissue: Minghui63 panicle, score: 98.797 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225843299 C A -0.03 -0.01 -0.01 -0.02 -0.03 -0.05
vg0225843299 C T -0.03 0.01 0.01 -0.01 -0.01 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225843299 NA 1.63E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 6.67E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 2.83E-07 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 1.84E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 5.23E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 6.33E-06 1.51E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 8.82E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 2.46E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 6.32E-08 NA mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 8.27E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 4.94E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225843299 NA 5.65E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251