Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225825647:

Variant ID: vg0225825647 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25825647
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTTGGTTTACAAAACGATTGGAAAACCCGACGCCTGGATCGGTGCCTTGTGAAAGAAATTGAGATTTAAAAATAAAAATCGTGACACAAGGCCATTC[C/A,T]
TGGGCGGAATGCTTGTGCGGTCGCATTTAAGGACCGATTCCTTCATAATTACATCCGAGCATATAATAGTGCAACCACATGGGTGGAGTGGGACACCCCT

Reverse complement sequence

AGGGGTGTCCCACTCCACCCATGTGGTTGCACTATTATATGCTCGGATGTAATTATGAAGGAATCGGTCCTTAAATGCGACCGCACAAGCATTCCGCCCA[G/T,A]
GAATGGCCTTGTGTCACGATTTTTATTTTTAAATCTCAATTTCTTTCACAAGGCACCGATCCAGGCGTCGGGTTTTCCAATCGTTTTGTAAACCAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.70%	2.30%	0.00%	0.00%	T: 0.02%
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	93.00%	7.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.00%	T: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	89.40%	10.60%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225825647	C -> A	LOC_Os02g42930.1	upstream_gene_variant ; 1498.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> A	LOC_Os02g42920.1	downstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> A	LOC_Os02g42940.1	downstream_gene_variant ; 2713.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> A	LOC_Os02g42930-LOC_Os02g42940	intergenic_region ; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> T	LOC_Os02g42930.1	upstream_gene_variant ; 1498.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> T	LOC_Os02g42920.1	downstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> T	LOC_Os02g42940.1	downstream_gene_variant ; 2713.0bp to feature; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0225825647	C -> T	LOC_Os02g42930-LOC_Os02g42940	intergenic_region ; MODIFIER	silent_mutation	Average:35.494; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225825647	NA	3.51E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	6.97E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	3.68E-06	3.68E-06	mr1015	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	4.05E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	2.94E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	7.00E-06	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	2.25E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	1.03E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	2.58E-07	2.58E-07	mr1480	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	2.41E-06	NA	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	NA	5.27E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225825647	8.49E-06	1.34E-07	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251