\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225824157:

Variant ID: vg0225824157 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25824157
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGCAGCCGCCTGGCATGGCCTCGCCGCCATTGCCGCCCGCTCCCGGGGGCCGCCGCCGTCGCCAGCCCTCCTCGGTGCCTCTCCTCCCCATCCGGCGC[C/T]
TGAAACGGATTCCCCGAGCCCCATAGATACTCCCACCGCCTTGAATCGAATCCTCATCGCCCCTCCGCCGTTTCCCCCTTTTCTCGTCGCCGGCGTGCGC

Reverse complement sequence

GCGCACGCCGGCGACGAGAAAAGGGGGAAACGGCGGAGGGGCGATGAGGATTCGATTCAAGGCGGTGGGAGTATCTATGGGGCTCGGGGAATCCGTTTCA[G/A]
GCGCCGGATGGGGAGGAGAGGCACCGAGGAGGGCTGGCGACGGCGGCGGCCCCCGGGAGCGGGCGGCAATGGCGGCGAGGCCATGCCAGGCGGCTGCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 14.00% 0.08% 0.00% NA
All Indica  2759 81.80% 18.10% 0.11% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 45.00% 54.60% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 78.10% 21.90% 0.00% 0.00% NA
Indica III  913 68.90% 30.90% 0.22% 0.00% NA
Indica Intermediate  786 85.20% 14.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225824157 C -> T LOC_Os02g42930.1 upstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0225824157 C -> T LOC_Os02g42920.1 downstream_gene_variant ; 3277.0bp to feature; MODIFIER silent_mutation Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0225824157 C -> T LOC_Os02g42940.1 downstream_gene_variant ; 4203.0bp to feature; MODIFIER silent_mutation Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0225824157 C -> T LOC_Os02g42930-LOC_Os02g42940 intergenic_region ; MODIFIER silent_mutation Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225824157 NA 1.79E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 6.38E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 2.64E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 5.83E-07 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 2.53E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 7.77E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 4.30E-07 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 2.02E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157 NA 3.00E-08 mr1892_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251