Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225824157:

Variant ID: vg0225824157 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25824157
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGCAGCCGCCTGGCATGGCCTCGCCGCCATTGCCGCCCGCTCCCGGGGGCCGCCGCCGTCGCCAGCCCTCCTCGGTGCCTCTCCTCCCCATCCGGCGC[C/T]
TGAAACGGATTCCCCGAGCCCCATAGATACTCCCACCGCCTTGAATCGAATCCTCATCGCCCCTCCGCCGTTTCCCCCTTTTCTCGTCGCCGGCGTGCGC

Reverse complement sequence

GCGCACGCCGGCGACGAGAAAAGGGGGAAACGGCGGAGGGGCGATGAGGATTCGATTCAAGGCGGTGGGAGTATCTATGGGGCTCGGGGAATCCGTTTCA[G/A]
GCGCCGGATGGGGAGGAGAGGCACCGAGGAGGGCTGGCGACGGCGGCGGCCCCCGGGAGCGGGCGGCAATGGCGGCGAGGCCATGCCAGGCGGCTGCGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.90%	14.00%	0.08%	0.00%	NA
All Indica	2759	81.80%	18.10%	0.11%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	45.00%	54.60%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	78.10%	21.90%	0.00%	0.00%	NA
Indica III	913	68.90%	30.90%	0.22%	0.00%	NA
Indica Intermediate	786	85.20%	14.60%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225824157	C -> T	LOC_Os02g42930.1	upstream_gene_variant ; 8.0bp to feature; MODIFIER	silent_mutation	Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg0225824157	C -> T	LOC_Os02g42920.1	downstream_gene_variant ; 3277.0bp to feature; MODIFIER	silent_mutation	Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg0225824157	C -> T	LOC_Os02g42940.1	downstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N
vg0225824157	C -> T	LOC_Os02g42930-LOC_Os02g42940	intergenic_region ; MODIFIER	silent_mutation	Average:66.606; most accessible tissue: Zhenshan97 young leaf, score: 85.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225824157	NA	1.79E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	6.38E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	2.64E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	5.83E-07	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	2.53E-06	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	7.77E-06	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	4.30E-07	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	2.02E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225824157	NA	3.00E-08	mr1892_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251