\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225607950:

Variant ID: vg0225607950 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25607950
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTATATTTTTAGTCTATATTTAATACTTTATACAGGTGTTTAAACGTTCTGTGATATCCCAGGGCTTAATAGGATTAATAGAATACTCATATCAAC[G/A]
AGTTGCAACTTCTTTTTCGGAAACCGATCTCCAAAGAACTCCAGGGTTAAGCGTGCTTGGCCTGGAGCAATTTGGGATGGGTGACCGACCGAGAAATTCT

Reverse complement sequence

AGAATTTCTCGGTCGGTCACCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCCTGGAGTTCTTTGGAGATCGGTTTCCGAAAAAGAAGTTGCAACT[C/T]
GTTGATATGAGTATTCTATTAATCCTATTAAGCCCTGGGATATCACAGAACGTTTAAACACCTGTATAAAGTATTAAATATAGACTAAAAATATAACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.50% 6.10% 13.97% 49.43% NA
All Indica  2759 3.00% 7.40% 12.47% 77.17% NA
All Japonica  1512 80.60% 0.70% 13.36% 5.36% NA
Aus  269 3.70% 23.40% 36.43% 36.43% NA
Indica I  595 0.80% 8.70% 13.78% 76.64% NA
Indica II  465 2.40% 11.40% 11.18% 75.05% NA
Indica III  913 2.70% 3.80% 12.27% 81.16% NA
Indica Intermediate  786 5.30% 8.00% 12.47% 74.17% NA
Temperate Japonica  767 78.50% 0.50% 16.04% 4.95% NA
Tropical Japonica  504 80.20% 1.40% 10.71% 7.74% NA
Japonica Intermediate  241 88.00% 0.00% 10.37% 1.66% NA
VI/Aromatic  96 93.80% 3.10% 2.08% 1.04% NA
Intermediate  90 45.60% 8.90% 15.56% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225607950 G -> A LOC_Os02g42585-LOC_Os02g42590 intergenic_region ; MODIFIER silent_mutation Average:47.044; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0225607950 G -> DEL N N silent_mutation Average:47.044; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225607950 NA 2.33E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 6.85E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 1.89E-06 7.75E-09 mr1042_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 5.29E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 1.08E-06 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 3.65E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 4.61E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 4.33E-06 2.04E-08 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 1.34E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 5.01E-06 5.01E-06 mr1630_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 7.64E-06 mr1677_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 6.77E-07 6.76E-07 mr1680_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 5.99E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 6.41E-07 4.01E-09 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 8.48E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 6.62E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225607950 NA 1.21E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251