\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225514496:

Variant ID: vg0225514496 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 25514496
Reference Allele: GAlternative Allele: A,GAATATTTGCAGTTTCTCATA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCAGAGTATATATCAACCTCAAGCAGCATTTCCCTATAACGTGCATGTACAGCGCACAACTTATAGGTCTAGTTTGAGAAGCTTCTGCAGTTTCTCAT[G/A,GAATATTTGCAGTTTCTCATA]
GAATATTCGGCTCACCCAAAGAAATCCAGATTGTCGCCTAAATTCTAAGAAAATGTAGTTGTAGAATCATGAACTAGAAGCCAGTTTCTCTATATTCTCA

Reverse complement sequence

TGAGAATATAGAGAAACTGGCTTCTAGTTCATGATTCTACAACTACATTTTCTTAGAATTTAGGCGACAATCTGGATTTCTTTGGGTGAGCCGAATATTC[C/T,TATGAGAAACTGCAAATATTC]
ATGAGAAACTGCAGAAGCTTCTCAAACTAGACCTATAAGTTGTGCGCTGTACATGCACGTTATAGGGAAATGCTGCTTGAGGTTGATATATACTCTGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 37.80% 0.57% 0.08% GAATATTTGCAGTTTCTCATA: 0.02%
All Indica  2759 38.90% 60.20% 0.65% 0.14% GAATATTTGCAGTTTCTCATA: 0.04%
All Japonica  1512 93.80% 5.70% 0.53% 0.00% NA
Aus  269 93.70% 5.90% 0.37% 0.00% NA
Indica I  595 41.50% 57.50% 1.01% 0.00% NA
Indica II  465 54.60% 44.50% 0.65% 0.22% NA
Indica III  913 29.10% 69.80% 0.66% 0.33% GAATATTTGCAGTTTCTCATA: 0.11%
Indica Intermediate  786 39.10% 60.60% 0.38% 0.00% NA
Temperate Japonica  767 97.70% 1.30% 1.04% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225514496 G -> A LOC_Os02g42406.1 upstream_gene_variant ; 909.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> A LOC_Os02g42412.1 downstream_gene_variant ; 12.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> A LOC_Os02g42420.1 downstream_gene_variant ; 3836.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> A LOC_Os02g42406-LOC_Os02g42412 intergenic_region ; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> DEL N N silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> GAATATTTGCAGTTTCTCATA LOC_Os02g42406.1 upstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> GAATATTTGCAGTTTCTCATA LOC_Os02g42412.1 downstream_gene_variant ; 11.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> GAATATTTGCAGTTTCTCATA LOC_Os02g42420.1 downstream_gene_variant ; 3835.0bp to feature; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N
vg0225514496 G -> GAATATTTGCAGTTTCTCATA LOC_Os02g42406-LOC_Os02g42412 intergenic_region ; MODIFIER silent_mutation Average:85.876; most accessible tissue: Callus, score: 97.092 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225514496 G A 0.04 0.02 0.02 0.01 0.02 0.02
vg0225514496 G GAATA* -0.29 -0.34 -0.41 -0.17 -0.23 -0.27

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225514496 4.16E-06 4.16E-06 mr1065 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 1.14E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 1.02E-12 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 2.07E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 2.12E-12 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 7.13E-07 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 6.59E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 3.76E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225514496 NA 3.64E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251