\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225470163:

Variant ID: vg0225470163 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 25470163
Reference Allele: CAAlternative Allele: AA,CAA,CAAA,CCCAAAA,C
Primary Allele: AASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATTGGCTATAGATGATTTGGAGCTAGTAGGGCTATACTATTAAACTTGCTCTTAGTCTGCATAACTGCACTGCAATGCATGTACTGTACTCCCTCCGT[CA/AA,CAA,CAAA,CCCAAAA,C]
AAAAAAAAAGCAAACCTTGGGTTTCCGTGCTAAAGTTTGACTGTCCATTTTATATGAATTTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAA

Reverse complement sequence

TTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAAATTCATATAAAATGGACAGTCAAACTTTAGCACGGAAACCCAAGGTTTGCTTTTTTTTT[TG/TT,TTG,TTTG,TTTTGGG,G]
ACGGAGGGAGTACAGTACATGCATTGCAGTGCAGTTATGCAGACTAAGAGCAAGTTTAATAGTATAGCCCTACTAGCTCCAAATCATCTATAGCCAATGT

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 32.60% 4.82% 1.10% CAA: 19.21%; CAAA: 0.13%; C: 0.11%; CCCAAAA: 0.04%
All Indica  2759 63.10% 16.00% 3.99% 1.59% CAA: 15.30%; CAAA: 0.04%
All Japonica  1512 4.60% 68.30% 6.68% 0.40% CAA: 19.44%; C: 0.33%; CAAA: 0.13%; CCCAAAA: 0.13%
Aus  269 55.40% 7.40% 0.37% 0.00% CAA: 36.80%
Indica I  595 79.50% 15.50% 3.03% 0.84% CAA: 1.18%
Indica II  465 55.30% 19.80% 1.72% 0.00% CAA: 23.23%
Indica III  913 60.80% 14.60% 5.15% 2.63% CAA: 16.76%; CAAA: 0.11%
Indica Intermediate  786 57.90% 15.90% 4.71% 1.91% CAA: 19.59%
Temperate Japonica  767 0.50% 84.10% 8.08% 0.26% CAA: 6.65%; C: 0.39%
Tropical Japonica  504 12.70% 41.50% 4.17% 0.00% CAA: 40.87%; CCCAAAA: 0.40%; CAAA: 0.20%; C: 0.20%
Japonica Intermediate  241 0.80% 73.90% 7.47% 1.66% CAA: 15.35%; C: 0.41%; CAAA: 0.41%
VI/Aromatic  96 0.00% 14.60% 5.21% 2.08% CAA: 75.00%; CAAA: 3.12%
Intermediate  90 27.80% 36.70% 12.22% 0.00% CAA: 23.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225470163 CA -> DEL N N silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> C LOC_Os02g42350.1 downstream_gene_variant ; 546.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> C LOC_Os02g42350.2 downstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> C LOC_Os02g42350-LOC_Os02g42360 intergenic_region ; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAAA LOC_Os02g42350.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAAA LOC_Os02g42350.2 downstream_gene_variant ; 1598.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAAA LOC_Os02g42350-LOC_Os02g42360 intergenic_region ; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> AA LOC_Os02g42350.1 downstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> AA LOC_Os02g42350.2 downstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> AA LOC_Os02g42350-LOC_Os02g42360 intergenic_region ; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CCCAAAA LOC_Os02g42350.1 downstream_gene_variant ; 546.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CCCAAAA LOC_Os02g42350.2 downstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CCCAAAA LOC_Os02g42350-LOC_Os02g42360 intergenic_region ; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAA LOC_Os02g42350.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAA LOC_Os02g42350.2 downstream_gene_variant ; 1598.0bp to feature; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0225470163 CA -> CAA LOC_Os02g42350-LOC_Os02g42360 intergenic_region ; MODIFIER silent_mutation Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225470163 NA 8.83E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 4.39E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 1.26E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 4.54E-08 mr1291_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 4.08E-09 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 1.96E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 1.47E-06 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 2.88E-06 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 2.78E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 5.79E-07 mr1642_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 4.17E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 1.07E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225470163 NA 1.52E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251