\
| Variant ID: vg0225470163 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 25470163 |
| Reference Allele: CA | Alternative Allele: AA,CAA,CAAA,CCCAAAA,C |
| Primary Allele: AA | Secondary Allele: CA |
Inferred Ancestral Allele: Not determined.
ACATTGGCTATAGATGATTTGGAGCTAGTAGGGCTATACTATTAAACTTGCTCTTAGTCTGCATAACTGCACTGCAATGCATGTACTGTACTCCCTCCGT[CA/AA,CAA,CAAA,CCCAAAA,C]
AAAAAAAAAGCAAACCTTGGGTTTCCGTGCTAAAGTTTGACTGTCCATTTTATATGAATTTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAA
TTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAAATTCATATAAAATGGACAGTCAAACTTTAGCACGGAAACCCAAGGTTTGCTTTTTTTTT[TG/TT,TTG,TTTG,TTTTGGG,G]
ACGGAGGGAGTACAGTACATGCATTGCAGTGCAGTTATGCAGACTAAGAGCAAGTTTAATAGTATAGCCCTACTAGCTCCAAATCATCTATAGCCAATGT
| Populations | Population Size | Frequency of AA(primary allele) | Frequency of CA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 32.60% | 4.82% | 1.10% | CAA: 19.21%; CAAA: 0.13%; C: 0.11%; CCCAAAA: 0.04% |
| All Indica | 2759 | 63.10% | 16.00% | 3.99% | 1.59% | CAA: 15.30%; CAAA: 0.04% |
| All Japonica | 1512 | 4.60% | 68.30% | 6.68% | 0.40% | CAA: 19.44%; C: 0.33%; CAAA: 0.13%; CCCAAAA: 0.13% |
| Aus | 269 | 55.40% | 7.40% | 0.37% | 0.00% | CAA: 36.80% |
| Indica I | 595 | 79.50% | 15.50% | 3.03% | 0.84% | CAA: 1.18% |
| Indica II | 465 | 55.30% | 19.80% | 1.72% | 0.00% | CAA: 23.23% |
| Indica III | 913 | 60.80% | 14.60% | 5.15% | 2.63% | CAA: 16.76%; CAAA: 0.11% |
| Indica Intermediate | 786 | 57.90% | 15.90% | 4.71% | 1.91% | CAA: 19.59% |
| Temperate Japonica | 767 | 0.50% | 84.10% | 8.08% | 0.26% | CAA: 6.65%; C: 0.39% |
| Tropical Japonica | 504 | 12.70% | 41.50% | 4.17% | 0.00% | CAA: 40.87%; CCCAAAA: 0.40%; CAAA: 0.20%; C: 0.20% |
| Japonica Intermediate | 241 | 0.80% | 73.90% | 7.47% | 1.66% | CAA: 15.35%; C: 0.41%; CAAA: 0.41% |
| VI/Aromatic | 96 | 0.00% | 14.60% | 5.21% | 2.08% | CAA: 75.00%; CAAA: 3.12% |
| Intermediate | 90 | 27.80% | 36.70% | 12.22% | 0.00% | CAA: 23.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225470163 | CA -> DEL | N | N | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> C | LOC_Os02g42350.1 | downstream_gene_variant ; 546.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> C | LOC_Os02g42350.2 | downstream_gene_variant ; 1597.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> C | LOC_Os02g42350-LOC_Os02g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAAA | LOC_Os02g42350.1 | downstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAAA | LOC_Os02g42350.2 | downstream_gene_variant ; 1598.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAAA | LOC_Os02g42350-LOC_Os02g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> AA | LOC_Os02g42350.1 | downstream_gene_variant ; 545.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> AA | LOC_Os02g42350.2 | downstream_gene_variant ; 1596.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> AA | LOC_Os02g42350-LOC_Os02g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CCCAAAA | LOC_Os02g42350.1 | downstream_gene_variant ; 546.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CCCAAAA | LOC_Os02g42350.2 | downstream_gene_variant ; 1597.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CCCAAAA | LOC_Os02g42350-LOC_Os02g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAA | LOC_Os02g42350.1 | downstream_gene_variant ; 547.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAA | LOC_Os02g42350.2 | downstream_gene_variant ; 1598.0bp to feature; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| vg0225470163 | CA -> CAA | LOC_Os02g42350-LOC_Os02g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:67.117; most accessible tissue: Minghui63 panicle, score: 91.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225470163 | NA | 8.83E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 4.39E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 1.26E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 4.54E-08 | mr1291_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 4.08E-09 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 1.96E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 1.47E-06 | mr1471_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 2.88E-06 | mr1477_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 2.78E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 5.79E-07 | mr1642_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 4.17E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 1.07E-07 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225470163 | NA | 1.52E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |