\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225446728:

Variant ID: vg0225446728 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25446728
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTAAGGATTAGTTAAAACAAACTTAACAAATGAATTAACGTAATTTTTTTAAATAACTTTTCTACAGAAAATATTTTTAAAAATGTACATATAGTTT[G/A]
GAAACGTACACGTGAAAAACGAACAACCGTCAGCTGTTGGTGCCGCCGATTCCCTTTTACCCACATATATAGCTCAGAGCAAGCTTCCAGAGACTAAAAG

Reverse complement sequence

CTTTTAGTCTCTGGAAGCTTGCTCTGAGCTATATATGTGGGTAAAAGGGAATCGGCGGCACCAACAGCTGACGGTTGTTCGTTTTTCACGTGTACGTTTC[C/T]
AAACTATATGTACATTTTTAAAAATATTTTCTGTAGAAAAGTTATTTAAAAAAATTACGTTAATTCATTTGTTAAGTTTGTTTTAACTAATCCTTAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 35.00% 1.90% 2.14% NA
All Indica  2759 41.30% 51.90% 3.15% 3.62% NA
All Japonica  1512 94.20% 5.70% 0.07% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 59.70% 39.50% 0.84% 0.00% NA
Indica II  465 54.20% 45.80% 0.00% 0.00% NA
Indica III  913 21.00% 61.70% 7.01% 10.30% NA
Indica Intermediate  786 43.30% 53.70% 2.29% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 84.90% 14.90% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 67.80% 30.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225446728 G -> A LOC_Os02g42310.3 upstream_gene_variant ; 632.0bp to feature; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> A LOC_Os02g42310.2 upstream_gene_variant ; 1095.0bp to feature; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> A LOC_Os02g42310.4 upstream_gene_variant ; 1121.0bp to feature; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> A LOC_Os02g42314.1 downstream_gene_variant ; 4164.0bp to feature; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> A LOC_Os02g42314.2 downstream_gene_variant ; 3486.0bp to feature; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> A LOC_Os02g42310.1 intron_variant ; MODIFIER silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N
vg0225446728 G -> DEL N N silent_mutation Average:89.576; most accessible tissue: Zhenshan97 flower, score: 96.805 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225446728 G A -0.01 0.0 0.0 -0.01 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225446728 NA 3.95E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.34E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 8.14E-06 NA mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 1.55E-06 3.37E-11 mr1072 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.98E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 2.14E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.93E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.04E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.26E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 8.80E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 4.50E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 5.81E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 7.81E-10 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 9.17E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.18E-10 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 4.60E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 2.96E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 8.77E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.36E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 1.79E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 8.73E-06 NA mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 3.57E-06 2.53E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225446728 NA 9.70E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251