\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225441549:

Variant ID: vg0225441549 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25441549
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTGCTTTGCAGTACGAGATAAAAAAAATGCTGTGATATCTCAAATTACTGAAAAAGCACTGCATGTGATTCTCTCTGGAGAAAAAAAAAGCGTATCAG[C/T]
AACGAATTTAGTATGTGATTAACTGCAGCGAGCATCATACGTAGAGTACAATAACAACATGAAACAGAGTATTTGACAATCAAAGCAAATAATGATATGT

Reverse complement sequence

ACATATCATTATTTGCTTTGATTGTCAAATACTCTGTTTCATGTTGTTATTGTACTCTACGTATGATGCTCGCTGCAGTTAATCACATACTAAATTCGTT[G/A]
CTGATACGCTTTTTTTTTCTCCAGAGAGAATCACATGCAGTGCTTTTTCAGTAATTTGAGATATCACAGCATTTTTTTTATCTCGTACTGCAAAGCAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.70% 0.11% 0.21% NA
All Indica  2759 40.70% 59.00% 0.07% 0.29% NA
All Japonica  1512 95.00% 4.80% 0.13% 0.00% NA
Aus  269 63.90% 35.30% 0.00% 0.74% NA
Indica I  595 60.00% 39.30% 0.34% 0.34% NA
Indica II  465 53.80% 46.00% 0.00% 0.22% NA
Indica III  913 19.40% 80.10% 0.00% 0.55% NA
Indica Intermediate  786 43.00% 57.00% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 86.50% 13.10% 0.40% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225441549 C -> T LOC_Os02g42310.1 upstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:57.333; most accessible tissue: Callus, score: 92.491 N N N N
vg0225441549 C -> T LOC_Os02g42300.1 downstream_gene_variant ; 2113.0bp to feature; MODIFIER silent_mutation Average:57.333; most accessible tissue: Callus, score: 92.491 N N N N
vg0225441549 C -> T LOC_Os02g42300-LOC_Os02g42310 intergenic_region ; MODIFIER silent_mutation Average:57.333; most accessible tissue: Callus, score: 92.491 N N N N
vg0225441549 C -> DEL N N silent_mutation Average:57.333; most accessible tissue: Callus, score: 92.491 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225441549 NA 1.30E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 6.19E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 9.81E-06 5.04E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 2.69E-06 2.69E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 5.31E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 2.80E-10 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 6.26E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 6.76E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 1.99E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 3.01E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 3.94E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 1.09E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 7.42E-11 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 9.48E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 2.38E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 8.94E-06 NA mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 3.15E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 3.91E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 4.75E-07 NA mr1222_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 1.33E-07 4.87E-08 mr1222_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225441549 NA 3.84E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251