\
| Variant ID: vg0225424171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25424171 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, A: 0.21, others allele: 0.00, population size: 101. )
CTTGCCGCGGCCGGAGTACTGATCCGTGTATCCGGCGGGGAGGCCGGCTCGCCACGACGGGTCGTCCTTGAGGACCCACAGGAACGGCCGGCCGGTGGCC[T/A]
CCAGGCCGACGGCGAGCTCGGTGATCTCGCCCGGCGCGATCGGCGCGACCCATGTCCCGAACGAGACGTACGCCACCGAACCTGGACGCTGCTGGTCGAG
CTCGACCAGCAGCGTCCAGGTTCGGTGGCGTACGTCTCGTTCGGGACATGGGTCGCGCCGATCGCGCCGGGCGAGATCACCGAGCTCGCCGTCGGCCTGG[A/T]
GGCCACCGGCCGGCCGTTCCTGTGGGTCCTCAAGGACGACCCGTCGTGGCGAGCCGGCCTCCCCGCCGGATACACGGATCAGTACTCCGGCCGCGGCAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 24.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 74.20% | 25.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.50% | 56.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225424171 | T -> A | LOC_Os02g42280.1 | missense_variant ; p.Glu361Val; MODERATE | nonsynonymous_codon ; E361V | Average:73.44; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | possibly damaging |
1.864 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225424171 | NA | 3.77E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 7.73E-07 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 1.50E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 6.69E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 8.45E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 9.60E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 5.32E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 1.72E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 5.85E-10 | mr1558_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225424171 | NA | 7.18E-06 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |