Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225413749:

Variant ID: vg0225413749 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25413749
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCCATGAGCTTCACCTCTACATCAAGCTTGGGCTCCGCTGCCATCGCCACTCTCGCTTCCTCCCCATCTGTCTTTCACCGCCACTCACACACACGCA[C/A]
ACACACACACATCGTCGTCAAAAACGTCTTATCTGAGCTTAGTCGATGGGGCTGGCCCCGTCATCCTCGCCAGCGGAGGGAGAGGAGAGGGAGTAAGGAG

Reverse complement sequence

CTCCTTACTCCCTCTCCTCTCCCTCCGCTGGCGAGGATGACGGGGCCAGCCCCATCGACTAAGCTCAGATAAGACGTTTTTGACGACGATGTGTGTGTGT[G/T]
TGCGTGTGTGTGAGTGGCGGTGAAAGACAGATGGGGAGGAAGCGAGAGTGGCGATGGCAGCGGAGCCCAAGCTTGATGTAGAGGTGAAGCTCATGGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 23.50% 2.35% 35.99% NA
All Indica  2759 16.50% 37.50% 1.81% 44.18% NA
All Japonica  1512 71.50% 4.00% 2.98% 21.49% NA
Aus  269 59.10% 0.40% 4.46% 36.06% NA
Indica I  595 6.70% 34.80% 2.18% 56.30% NA
Indica II  465 31.20% 23.00% 0.86% 44.95% NA
Indica III  913 12.40% 45.90% 1.53% 40.20% NA
Indica Intermediate  786 20.10% 38.30% 2.42% 39.19% NA
Temperate Japonica  767 80.80% 0.40% 2.87% 15.91% NA
Tropical Japonica  504 56.30% 10.70% 2.38% 30.56% NA
Japonica Intermediate  241 73.40% 1.70% 4.56% 20.33% NA
VI/Aromatic  96 66.70% 0.00% 0.00% 33.33% NA
Intermediate  90 48.90% 15.60% 4.44% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225413749 C -> A LOC_Os02g42250.1 upstream_gene_variant ; 1281.0bp to feature; MODIFIER silent_mutation Average:73.872; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0225413749 C -> A LOC_Os02g42270.1 downstream_gene_variant ; 962.0bp to feature; MODIFIER silent_mutation Average:73.872; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0225413749 C -> A LOC_Os02g42250-LOC_Os02g42270 intergenic_region ; MODIFIER silent_mutation Average:73.872; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0225413749 C -> DEL N N silent_mutation Average:73.872; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225413749 C A -0.04 -0.04 -0.03 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225413749 NA 1.92E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 2.84E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 6.31E-06 5.62E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.99E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 4.23E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 2.75E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 9.15E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 6.51E-06 NA mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 8.52E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.68E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 6.44E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.13E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 9.06E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 8.25E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 4.64E-10 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 4.46E-06 NA mr1072_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 2.99E-06 NA mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 6.28E-06 NA mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 4.58E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.25E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 6.43E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.26E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 3.98E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 3.79E-10 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.63E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 3.16E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 1.96E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225413749 NA 5.25E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251