\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225412891:

Variant ID: vg0225412891 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25412891
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AACAACGATGTTTTGTCTCTCATCTTTCTCTTTCTTCCATATCAACAAATATTTCTAATTAGCAATGCTAAGAGACCACTATTGATAACCATTGTATATG[C/T]
CCTAACAATCAACACAACATGAAACTTGGGAAACTATCTGAACTATCAAGGAAATACACACTCACTATTTTACATATCATTTACTGATTTACATGGTTAT

Reverse complement sequence

ATAACCATGTAAATCAGTAAATGATATGTAAAATAGTGAGTGTGTATTTCCTTGATAGTTCAGATAGTTTCCCAAGTTTCATGTTGTGTTGATTGTTAGG[G/A]
CATATACAATGGTTATCAATAGTGGTCTCTTAGCATTGCTAATTAGAAATATTTGTTGATATGGAAGAAAGAGAAAGATGAGAGACAAAACATCGTTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.10% 0.40% 0.00% NA
All Indica  2759 49.50% 49.90% 0.58% 0.00% NA
All Japonica  1512 95.90% 4.00% 0.13% 0.00% NA
Aus  269 63.90% 36.10% 0.00% 0.00% NA
Indica I  595 64.20% 35.10% 0.67% 0.00% NA
Indica II  465 53.30% 46.70% 0.00% 0.00% NA
Indica III  913 39.90% 59.40% 0.77% 0.00% NA
Indica Intermediate  786 47.20% 52.20% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 10.70% 0.40% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225412891 C -> T LOC_Os02g42230.1 upstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:26.75; most accessible tissue: Callus, score: 50.648 N N N N
vg0225412891 C -> T LOC_Os02g42250.1 upstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:26.75; most accessible tissue: Callus, score: 50.648 N N N N
vg0225412891 C -> T LOC_Os02g42270.1 downstream_gene_variant ; 1820.0bp to feature; MODIFIER silent_mutation Average:26.75; most accessible tissue: Callus, score: 50.648 N N N N
vg0225412891 C -> T LOC_Os02g42250-LOC_Os02g42270 intergenic_region ; MODIFIER silent_mutation Average:26.75; most accessible tissue: Callus, score: 50.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225412891 NA 4.44E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 3.96E-06 1.40E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 6.55E-06 1.74E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 1.06E-06 3.04E-09 mr1075 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 1.37E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 8.46E-10 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 4.65E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 3.41E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 6.50E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 2.39E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 3.10E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 9.38E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 4.33E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 6.80E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 5.68E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 8.68E-07 1.36E-10 mr1861 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 1.28E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 1.46E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 4.98E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 1.85E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 8.42E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 3.61E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 8.64E-06 1.10E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 4.06E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 3.24E-06 NA mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 4.48E-07 2.72E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 1.28E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225412891 NA 3.49E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251