\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225398984:

Variant ID: vg0225398984 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25398984
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAATCCACCATGCCACCTCGCCTCGCACAAGCGATCTCGCTAAGAGAAGTACAATAACACAACGTACTGTAAACTAGCTATAAACAGATAAAAGAAGA[G/A]
AGAGAAAAGCAGCGGGCTACATATCTGTAGCCAGCTGCAGCACGATCTCTAAGACGTAATGTGTGTATGATAAATAGGACTAGATATTAATAGTATAGGA

Reverse complement sequence

TCCTATACTATTAATATCTAGTCCTATTTATCATACACACATTACGTCTTAGAGATCGTGCTGCAGCTGGCTACAGATATGTAGCCCGCTGCTTTTCTCT[C/T]
TCTTCTTTTATCTGTTTATAGCTAGTTTACAGTACGTTGTGTTATTGTACTTCTCTTAGCGAGATCGCTTGTGCGAGGCGAGGTGGCATGGTGGATTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 14.10% 13.01% 35.21% NA
All Indica  2759 28.10% 18.10% 18.27% 35.56% NA
All Japonica  1512 61.10% 4.60% 3.51% 30.82% NA
Aus  269 7.10% 29.70% 15.61% 47.58% NA
Indica I  595 59.50% 12.60% 17.65% 10.25% NA
Indica II  465 26.70% 10.10% 21.72% 41.51% NA
Indica III  913 8.50% 26.30% 13.58% 51.59% NA
Indica Intermediate  786 27.70% 17.60% 22.14% 32.57% NA
Temperate Japonica  767 80.60% 1.40% 1.69% 16.30% NA
Tropical Japonica  504 36.30% 8.10% 6.55% 49.01% NA
Japonica Intermediate  241 51.00% 7.10% 2.90% 39.00% NA
VI/Aromatic  96 28.10% 4.20% 4.17% 63.54% NA
Intermediate  90 42.20% 13.30% 13.33% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225398984 G -> A LOC_Os02g42220.1 upstream_gene_variant ; 819.0bp to feature; MODIFIER silent_mutation Average:97.808; most accessible tissue: Zhenshan97 young leaf, score: 99.155 N N N N
vg0225398984 G -> A LOC_Os02g42210.1 downstream_gene_variant ; 4219.0bp to feature; MODIFIER silent_mutation Average:97.808; most accessible tissue: Zhenshan97 young leaf, score: 99.155 N N N N
vg0225398984 G -> A LOC_Os02g42210-LOC_Os02g42220 intergenic_region ; MODIFIER silent_mutation Average:97.808; most accessible tissue: Zhenshan97 young leaf, score: 99.155 N N N N
vg0225398984 G -> DEL N N silent_mutation Average:97.808; most accessible tissue: Zhenshan97 young leaf, score: 99.155 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225398984 G A -0.02 -0.05 -0.05 -0.02 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225398984 NA 2.63E-09 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.68E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 2.87E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.84E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 2.08E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 2.41E-08 mr1179 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 9.70E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.41E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 6.21E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.68E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.24E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.93E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 7.67E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 8.63E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 1.54E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 7.00E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 5.90E-08 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 4.33E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225398984 NA 4.18E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251