\
| Variant ID: vg0225359930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25359930 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.02, others allele: 0.00, population size: 63. )
AAGGGGTAGGAGATGCCATCGACTTCCCCGCAGCTAGAGGGGCAGTGAGCGAGGGAGTCATTAGAAGGGACAATCAAGAGCCCTCCACCAACTCCATAGA[C/T]
TGAAGCCAATACTCGTGGCGTAGCTGCCGAGCACACCAGCACAAAAGAAGTGGCACAAACTGCCAGAAAGCTCGAGCTCATCTTTGCGCCAGCCGGCTTG
CAAGCCGGCTGGCGCAAAGATGAGCTCGAGCTTTCTGGCAGTTTGTGCCACTTCTTTTGTGCTGGTGTGCTCGGCAGCTACGCCACGAGTATTGGCTTCA[G/A]
TCTATGGAGTTGGTGGAGGGCTCTTGATTGTCCCTTCTAATGACTCCCTCGCTCACTGCCCCTCTAGCTGCGGGGAAGTCGATGGCATCTCCTACCCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 22.20% | 0.68% | 41.30% | NA |
| All Indica | 2759 | 17.00% | 25.40% | 0.76% | 56.80% | NA |
| All Japonica | 1512 | 72.60% | 19.90% | 0.60% | 6.94% | NA |
| Aus | 269 | 7.10% | 3.00% | 0.00% | 89.96% | NA |
| Indica I | 595 | 7.10% | 57.30% | 0.34% | 35.29% | NA |
| Indica II | 465 | 7.10% | 25.60% | 1.72% | 65.59% | NA |
| Indica III | 913 | 31.00% | 6.80% | 0.55% | 61.66% | NA |
| Indica Intermediate | 786 | 14.10% | 22.90% | 0.76% | 62.21% | NA |
| Temperate Japonica | 767 | 80.70% | 17.30% | 0.65% | 1.30% | NA |
| Tropical Japonica | 504 | 66.30% | 20.60% | 0.20% | 12.90% | NA |
| Japonica Intermediate | 241 | 59.80% | 26.60% | 1.24% | 12.45% | NA |
| VI/Aromatic | 96 | 63.50% | 25.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 51.10% | 16.70% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225359930 | C -> T | LOC_Os02g42160.1 | missense_variant ; p.Val28Ile; MODERATE | nonsynonymous_codon ; V28I | Average:76.004; most accessible tissue: Callus, score: 97.453 | unknown | unknown | TOLERATED | 0.29 |
| vg0225359930 | C -> DEL | LOC_Os02g42160.1 | N | frameshift_variant | Average:76.004; most accessible tissue: Callus, score: 97.453 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225359930 | NA | 5.02E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 4.90E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 1.29E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | 3.59E-07 | 3.59E-07 | mr1270 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 1.55E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 2.04E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 3.66E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 4.72E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 5.02E-06 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 4.45E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 2.66E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 1.21E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 3.22E-08 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225359930 | NA | 9.88E-06 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |