\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225359588:

Variant ID: vg0225359588 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25359588
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.27, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCTATTGCTATTGGTGCCTTCTCAATGTCACATCTACTCATACAAGAACCAACGAAATCTCCCGTACCAAACTCGAACAAGGTGGCATCAAAATTACAAC[A/C]
GACAACATAGAAAGTGTTCTCATCTGAAATTTTAATACCCTTAGCTGGCGACACCCATGAAATGTTGTAGGTGTCCATACCTTGCCTTGTCGTAAAATTG

Reverse complement sequence

CAATTTTACGACAAGGCAAGGTATGGACACCTACAACATTTCATGGGTGTCGCCAGCTAAGGGTATTAAAATTTCAGATGAGAACACTTTCTATGTTGTC[T/G]
GTTGTAATTTTGATGCCACCTTGTTCGAGTTTGGTACGGGAGATTTCGTTGGTTCTTGTATGAGTAGATGTGACATTGAGAAGGCACCAATAGCAATAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 11.60% 0.21% 43.19% NA
All Indica  2759 39.40% 1.10% 0.25% 59.30% NA
All Japonica  1512 59.40% 33.10% 0.13% 7.34% NA
Aus  269 5.60% 0.00% 0.00% 94.42% NA
Indica I  595 62.90% 1.70% 0.00% 35.46% NA
Indica II  465 29.00% 1.50% 0.86% 68.60% NA
Indica III  913 34.70% 0.10% 0.00% 65.17% NA
Indica Intermediate  786 33.10% 1.50% 0.38% 65.01% NA
Temperate Japonica  767 39.10% 59.20% 0.26% 1.43% NA
Tropical Japonica  504 85.70% 1.20% 0.00% 13.10% NA
Japonica Intermediate  241 68.90% 17.00% 0.00% 14.11% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 50.00% 16.70% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225359588 A -> DEL LOC_Os02g42160.1 N frameshift_variant Average:74.871; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N
vg0225359588 A -> C LOC_Os02g42160.1 missense_variant ; p.Cys142Gly; MODERATE nonsynonymous_codon ; C142G Average:74.871; most accessible tissue: Zhenshan97 root, score: 83.087 probably damaging -3.734 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225359588 NA 3.42E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225359588 NA 9.65E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225359588 NA 6.62E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225359588 NA 1.92E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225359588 NA 1.64E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0225359588 NA 1.53E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 5.33E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 3.74E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.41E-06 mr1761 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 7.78E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.14E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 4.63E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 3.44E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 3.12E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.36E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 6.72E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 3.74E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 5.11E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.32E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.05E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 1.21E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225359588 NA 7.50E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251