\
| Variant ID: vg0225318037 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25318037 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 76. )
ATAGATTGTCCATTGTGAGGTCCAAATATCGCTGATAGGGGTGGTGCGGCATAACAATCATCACTACTGCTCCCTCCGTTTCAGGTTATAAGACTTTCTA[A/G]
CATTGCCCATATTCATATAGATGTTAATGAATCTAGTCACATATAAATGTTTAGATTCATTAACATATATATATGAATATGGGCAATGCTAGAAGGTCTT
AAGACCTTCTAGCATTGCCCATATTCATATATATATGTTAATGAATCTAAACATTTATATGTGACTAGATTCATTAACATCTATATGAATATGGGCAATG[T/C]
TAGAAAGTCTTATAACCTGAAACGGAGGGAGCAGTAGTGATGATTGTTATGCCGCACCACCCCTATCAGCGATATTTGGACCTCACAATGGACAATCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 27.50% | 0.17% | 1.04% | NA |
| All Indica | 2759 | 79.50% | 19.20% | 0.11% | 1.12% | NA |
| All Japonica | 1512 | 51.40% | 47.60% | 0.00% | 1.06% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.70% | 20.50% | 0.00% | 0.84% | NA |
| Indica II | 465 | 74.20% | 24.90% | 0.65% | 0.22% | NA |
| Indica III | 913 | 86.60% | 11.50% | 0.00% | 1.86% | NA |
| Indica Intermediate | 786 | 75.10% | 23.90% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 36.80% | 63.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.00% | 22.80% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 48.50% | 49.40% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 75.00% | 19.80% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225318037 | A -> G | LOC_Os02g42120.1 | upstream_gene_variant ; 4888.0bp to feature; MODIFIER | silent_mutation | Average:42.989; most accessible tissue: Callus, score: 79.881 | N | N | N | N |
| vg0225318037 | A -> G | LOC_Os02g42110.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.989; most accessible tissue: Callus, score: 79.881 | N | N | N | N |
| vg0225318037 | A -> DEL | N | N | silent_mutation | Average:42.989; most accessible tissue: Callus, score: 79.881 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225318037 | NA | 4.65E-06 | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225318037 | NA | 6.34E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225318037 | 4.83E-06 | 4.83E-06 | mr1761 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225318037 | NA | 9.83E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |