\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225285088:

Variant ID: vg0225285088 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25285088
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CCCACATGTCAGTCCTCTTCCTCCTCCCTATCTCCCTTCTCTCTCTTTCTCTCCCCTTCTTCCCATTCGGCCGACAGGCAGGAGGGCGGCGAGAGCGAGC[G/T]
GGCGGCATCGGGGCGCATCAGAACCGAACTGGGGGCAGCGGTCGGCGGCTAGGACGGCGGCGGCTCGGCGGCGGCGACGGCGAGGGGAACGGCGGCGGCG

Reverse complement sequence

CGCCGCCGCCGTTCCCCTCGCCGTCGCCGCCGCCGAGCCGCCGCCGTCCTAGCCGCCGACCGCTGCCCCCAGTTCGGTTCTGATGCGCCCCGATGCCGCC[C/A]
GCTCGCTCTCGCCGCCCTCCTGCCTGTCGGCCGAATGGGAAGAAGGGGAGAGAAAGAGAGAGAAGGGAGATAGGGAGGAGGAAGAGGACTGACATGTGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.10% 1.06% 0.02% NA
All Indica  2759 82.30% 17.30% 0.29% 0.04% NA
All Japonica  1512 38.30% 59.10% 2.58% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 78.50% 20.70% 0.84% 0.00% NA
Indica II  465 75.30% 24.50% 0.22% 0.00% NA
Indica III  913 93.40% 6.50% 0.00% 0.11% NA
Indica Intermediate  786 76.60% 23.20% 0.25% 0.00% NA
Temperate Japonica  767 31.20% 65.40% 3.39% 0.00% NA
Tropical Japonica  504 43.30% 56.30% 0.40% 0.00% NA
Japonica Intermediate  241 50.60% 44.80% 4.56% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225285088 G -> T LOC_Os02g42050.1 synonymous_variant ; p.Ala32Ala; LOW synonymous_codon Average:82.036; most accessible tissue: Minghui63 panicle, score: 95.346 N N N N
vg0225285088 G -> DEL LOC_Os02g42050.1 N frameshift_variant Average:82.036; most accessible tissue: Minghui63 panicle, score: 95.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225285088 G T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225285088 NA 1.55E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 4.94E-06 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 5.37E-06 5.36E-06 mr1290 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 2.66E-06 2.66E-06 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 1.52E-06 1.52E-06 mr1396 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 3.38E-06 3.38E-06 mr1445 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 6.56E-06 6.57E-06 mr1452 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 5.15E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 4.40E-06 4.40E-06 mr1472 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 1.16E-06 1.16E-06 mr1513 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 2.36E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 3.29E-06 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 8.42E-07 8.42E-07 mr1761 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 2.50E-07 mr1875 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 8.31E-06 mr1931 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 3.96E-06 3.96E-06 mr1941 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 NA 3.82E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225285088 1.88E-06 1.88E-06 mr1416_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251