Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225272614:

Variant ID: vg0225272614 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25272614
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, A: 0.36, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCACAACACGATGATATTTTCACAACTGTTGATCTAAGCGCTAGATAGAAAGGGATCGAATTCTGCAGCCGTGGAGGCAATTACCACAAGTTGGTTG[C/A]
GTCCACTGCGCGAAGGTCCATTCAGGGCACAAAACCTCGCTTTCTCCGGCGTAATTATTCCGTGTAAAGCAGCAGCGCATCTCGTGGCAGACACGCGTAG

Reverse complement sequence

CTACGCGTGTCTGCCACGAGATGCGCTGCTGCTTTACACGGAATAATTACGCCGGAGAAAGCGAGGTTTTGTGCCCTGAATGGACCTTCGCGCAGTGGAC[G/T]
CAACCAACTTGTGGTAATTGCCTCCACGGCTGCAGAATTCGATCCCTTTCTATCTAGCGCTTAGATCAACAGTTGTGAAAATATCATCGTGTTGTGAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.40% 0.08% 0.00% NA
All Indica  2759 77.70% 22.10% 0.14% 0.00% NA
All Japonica  1512 59.30% 40.70% 0.00% 0.00% NA
Aus  269 52.00% 48.00% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 75.90% 24.10% 0.00% 0.00% NA
Indica III  913 67.50% 32.40% 0.11% 0.00% NA
Indica Intermediate  786 77.90% 21.80% 0.38% 0.00% NA
Temperate Japonica  767 64.70% 35.30% 0.00% 0.00% NA
Tropical Japonica  504 58.10% 41.90% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225272614 C -> A LOC_Os02g42040.1 downstream_gene_variant ; 430.0bp to feature; MODIFIER silent_mutation Average:90.923; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N
vg0225272614 C -> A LOC_Os02g42030-LOC_Os02g42040 intergenic_region ; MODIFIER silent_mutation Average:90.923; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225272614 C A -0.03 -0.16 -0.14 0.0 -0.08 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225272614 NA 3.30E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 8.04E-06 8.04E-06 mr1384 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 7.11E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 7.16E-07 7.16E-07 mr1472 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 4.00E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 6.97E-07 6.97E-07 mr1761 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 5.89E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 3.75E-06 mr1875 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 3.11E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225272614 NA 6.84E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251