Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225218022:

Variant ID: vg0225218022 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25218022
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATAAGCCTATTTTTGAAAGCGGACCTCTTAAGGGACCGCACGAGAAAATATATTTTTGCAGGCGGGCCTCCTAAGGATCCACCTAAATTCTAAGTT[A/T]
CCTCCTTATTTTTCTCTAACATTTCAAAATTTTTCATCCTTATCCACTCATCTCTCTCTCTCACCTTCTATCCTCATTATTTTCTCTCCACTCTCTCACC

Reverse complement sequence

GGTGAGAGAGTGGAGAGAAAATAATGAGGATAGAAGGTGAGAGAGAGAGATGAGTGGATAAGGATGAAAAATTTTGAAATGTTAGAGAAAAATAAGGAGG[T/A]
AACTTAGAATTTAGGTGGATCCTTAGGAGGCCCGCCTGCAAAAATATATTTTCTCGTGCGGTCCCTTAAGAGGTCCGCTTTCAAAAATAGGCTTATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	12.90%	0.34%	0.00%	NA
All Indica	2759	82.20%	17.20%	0.58%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	74.70%	25.30%	0.00%	0.00%	NA
Indica I	595	61.30%	36.60%	2.02%	0.00%	NA
Indica II	465	93.50%	6.20%	0.22%	0.00%	NA
Indica III	913	84.90%	15.10%	0.00%	0.00%	NA
Indica Intermediate	786	88.30%	11.30%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225218022	A -> T	LOC_Os02g41970.1	upstream_gene_variant ; 2940.0bp to feature; MODIFIER	silent_mutation	Average:45.671; most accessible tissue: Callus, score: 71.666	N	N	N	N
vg0225218022	A -> T	LOC_Os02g41961.1	downstream_gene_variant ; 1599.0bp to feature; MODIFIER	silent_mutation	Average:45.671; most accessible tissue: Callus, score: 71.666	N	N	N	N
vg0225218022	A -> T	LOC_Os02g41961-LOC_Os02g41970	intergenic_region ; MODIFIER	silent_mutation	Average:45.671; most accessible tissue: Callus, score: 71.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225218022	NA	1.56E-09	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	6.61E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	3.35E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	1.10E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	2.10E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	6.15E-06	mr1291_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	2.60E-08	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	1.84E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	1.57E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	1.03E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	9.35E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	1.30E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225218022	NA	3.55E-10	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251