\
| Variant ID: vg0225217180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25217180 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )
TGTATGCAATTCTTGTAAGCCGATGCAACGTCCGGATAACTCATCGGCTGAAACCCCGGTGAAACCCTTATTGGCTGGCAAAAAGCAGGCTAGGGATTAT[G/A]
GTTCTAAACATGACTTAGTAGATCAAACTTAACTGATGCAACACTAAGTACGAAAAGAAACACAATATCTAGACAATCAAGCCGTTTACTGATTTTCAGG
CCTGAAAATCAGTAAACGGCTTGATTGTCTAGATATTGTGTTTCTTTTCGTACTTAGTGTTGCATCAGTTAAGTTTGATCTACTAAGTCATGTTTAGAAC[C/T]
ATAATCCCTAGCCTGCTTTTTGCCAGCCAATAAGGGTTTCACCGGGGTTTCAGCCGATGAGTTATCCGGACGTTGCATCGGCTTACAAGAATTGCATACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 86.10% | 13.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 15.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225217180 | G -> A | LOC_Os02g41970.1 | upstream_gene_variant ; 3782.0bp to feature; MODIFIER | silent_mutation | Average:33.076; most accessible tissue: Callus, score: 38.958 | N | N | N | N |
| vg0225217180 | G -> A | LOC_Os02g41961.1 | downstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:33.076; most accessible tissue: Callus, score: 38.958 | N | N | N | N |
| vg0225217180 | G -> A | LOC_Os02g41961-LOC_Os02g41970 | intergenic_region ; MODIFIER | silent_mutation | Average:33.076; most accessible tissue: Callus, score: 38.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225217180 | NA | 5.87E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 2.20E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 1.34E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 1.49E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 4.24E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 3.82E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | 3.38E-06 | 7.06E-07 | mr1619 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 8.11E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225217180 | NA | 2.96E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |