Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225217180:

Variant ID: vg0225217180 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25217180
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATGCAATTCTTGTAAGCCGATGCAACGTCCGGATAACTCATCGGCTGAAACCCCGGTGAAACCCTTATTGGCTGGCAAAAAGCAGGCTAGGGATTAT[G/A]
GTTCTAAACATGACTTAGTAGATCAAACTTAACTGATGCAACACTAAGTACGAAAAGAAACACAATATCTAGACAATCAAGCCGTTTACTGATTTTCAGG

Reverse complement sequence

CCTGAAAATCAGTAAACGGCTTGATTGTCTAGATATTGTGTTTCTTTTCGTACTTAGTGTTGCATCAGTTAAGTTTGATCTACTAAGTCATGTTTAGAAC[C/T]
ATAATCCCTAGCCTGCTTTTTGCCAGCCAATAAGGGTTTCACCGGGGTTTCAGCCGATGAGTTATCCGGACGTTGCATCGGCTTACAAGAATTGCATACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	12.50%	0.02%	0.00%	NA
All Indica	2759	86.10%	13.80%	0.04%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	76.30%	23.70%	0.00%	0.00%	NA
Indica III	913	84.20%	15.80%	0.00%	0.00%	NA
Indica Intermediate	786	84.10%	15.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225217180	G -> A	LOC_Os02g41970.1	upstream_gene_variant ; 3782.0bp to feature; MODIFIER	silent_mutation	Average:33.076; most accessible tissue: Callus, score: 38.958	N	N	N	N
vg0225217180	G -> A	LOC_Os02g41961.1	downstream_gene_variant ; 757.0bp to feature; MODIFIER	silent_mutation	Average:33.076; most accessible tissue: Callus, score: 38.958	N	N	N	N
vg0225217180	G -> A	LOC_Os02g41961-LOC_Os02g41970	intergenic_region ; MODIFIER	silent_mutation	Average:33.076; most accessible tissue: Callus, score: 38.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225217180	NA	5.87E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	2.20E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	1.34E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	1.49E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	4.24E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	3.82E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	3.38E-06	7.06E-07	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	8.11E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180	NA	2.96E-06	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251