Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225217180:

Variant ID: vg0225217180 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25217180
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TGTATGCAATTCTTGTAAGCCGATGCAACGTCCGGATAACTCATCGGCTGAAACCCCGGTGAAACCCTTATTGGCTGGCAAAAAGCAGGCTAGGGATTAT[G/A]
GTTCTAAACATGACTTAGTAGATCAAACTTAACTGATGCAACACTAAGTACGAAAAGAAACACAATATCTAGACAATCAAGCCGTTTACTGATTTTCAGG

Reverse complement sequence

CCTGAAAATCAGTAAACGGCTTGATTGTCTAGATATTGTGTTTCTTTTCGTACTTAGTGTTGCATCAGTTAAGTTTGATCTACTAAGTCATGTTTAGAAC[C/T]
ATAATCCCTAGCCTGCTTTTTGCCAGCCAATAAGGGTTTCACCGGGGTTTCAGCCGATGAGTTATCCGGACGTTGCATCGGCTTACAAGAATTGCATACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.50% 0.02% 0.00% NA
All Indica  2759 86.10% 13.80% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 76.30% 23.70% 0.00% 0.00% NA
Indica III  913 84.20% 15.80% 0.00% 0.00% NA
Indica Intermediate  786 84.10% 15.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225217180 G -> A LOC_Os02g41970.1 upstream_gene_variant ; 3782.0bp to feature; MODIFIER silent_mutation Average:33.076; most accessible tissue: Callus, score: 38.958 N N N N
vg0225217180 G -> A LOC_Os02g41961.1 downstream_gene_variant ; 757.0bp to feature; MODIFIER silent_mutation Average:33.076; most accessible tissue: Callus, score: 38.958 N N N N
vg0225217180 G -> A LOC_Os02g41961-LOC_Os02g41970 intergenic_region ; MODIFIER silent_mutation Average:33.076; most accessible tissue: Callus, score: 38.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225217180 NA 5.87E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 2.20E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 1.34E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 1.49E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 4.24E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 3.82E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 3.38E-06 7.06E-07 mr1619 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 8.11E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225217180 NA 2.96E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251