\
| Variant ID: vg0225208298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25208298 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCAAGGGTGGATGCTTCCTCTTCTTTTCCTTTTTCTTCCTATGCAAATTTCTTTCAGAAATTATATCTTTTCTTTCTCTAGCAAAGGTGATCATATCCT[A/G]
TTATTATTTTTTTAAACGACCCACACACGACAGTGCGAAATTTCGTATTTGATATAACAGGAAAAAAAACAAGATTAATTACAATCCTGCGATATCGTAA
TTACGATATCGCAGGATTGTAATTAATCTTGTTTTTTTTCCTGTTATATCAAATACGAAATTTCGCACTGTCGTGTGTGGGTCGTTTAAAAAAATAATAA[T/C]
AGGATATGATCACCTTTGCTAGAGAAAGAAAAGATATAATTTCTGAAAGAAATTTGCATAGGAAGAAAAAGGAAAAGAAGAGGAAGCATCCACCCTTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 89.40% | 10.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.00% | 21.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225208298 | A -> G | LOC_Os02g41954.1 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:43.881; most accessible tissue: Callus, score: 93.67 | N | N | N | N |
| vg0225208298 | A -> G | LOC_Os02g41961.1 | upstream_gene_variant ; 3434.0bp to feature; MODIFIER | silent_mutation | Average:43.881; most accessible tissue: Callus, score: 93.67 | N | N | N | N |
| vg0225208298 | A -> G | LOC_Os02g41954.2 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:43.881; most accessible tissue: Callus, score: 93.67 | N | N | N | N |
| vg0225208298 | A -> G | LOC_Os02g41954-LOC_Os02g41961 | intergenic_region ; MODIFIER | silent_mutation | Average:43.881; most accessible tissue: Callus, score: 93.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225208298 | 6.26E-06 | 6.26E-06 | mr1356 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | 3.79E-06 | 3.79E-06 | mr1375 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | NA | 8.18E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | 3.44E-06 | 3.44E-06 | mr1571 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | 6.71E-07 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | NA | 1.47E-06 | mr1921 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | NA | 4.27E-06 | mr1931 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225208298 | 2.21E-06 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |