\
| Variant ID: vg0225207585 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25207585 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAACTGTATGAAGTATTAAATATATGCTAAAAAAACTAATTACATAGATTATGACTAATTTGCGAGACGAATCTTTTAAGTCTAATTGCTCCATGATTT[G/A]
ATAATATGGTGCTACAGTAAACATTTGCTAATGATAGATTAATTAGGCTTAATAAATTCGTCTCGAGGTTTACTGATTGATTCTGTAATAAGTTTTCTTA
TAAGAAAACTTATTACAGAATCAATCAGTAAACCTCGAGACGAATTTATTAAGCCTAATTAATCTATCATTAGCAAATGTTTACTGTAGCACCATATTAT[C/T]
AAATCATGGAGCAATTAGACTTAAAAGATTCGTCTCGCAAATTAGTCATAATCTATGTAATTAGTTTTTTTAGCATATATTTAATACTTCATACAGTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 12.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 83.10% | 16.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.90% | 23.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.60% | 17.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225207585 | G -> A | LOC_Os02g41954.1 | upstream_gene_variant ; 3843.0bp to feature; MODIFIER | silent_mutation | Average:55.142; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0225207585 | G -> A | LOC_Os02g41961.1 | upstream_gene_variant ; 4147.0bp to feature; MODIFIER | silent_mutation | Average:55.142; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0225207585 | G -> A | LOC_Os02g41954.2 | upstream_gene_variant ; 3843.0bp to feature; MODIFIER | silent_mutation | Average:55.142; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0225207585 | G -> A | LOC_Os02g41954-LOC_Os02g41961 | intergenic_region ; MODIFIER | silent_mutation | Average:55.142; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225207585 | NA | 5.21E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 5.06E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 1.86E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 2.00E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 6.85E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 6.18E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 9.80E-06 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 2.25E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 7.03E-07 | mr1592 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 8.16E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 3.16E-07 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 5.66E-06 | 8.95E-08 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 2.53E-07 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 4.17E-09 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 1.16E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 6.44E-06 | 1.34E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 3.17E-07 | 1.56E-07 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 7.62E-07 | 2.38E-08 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 4.55E-07 | 1.38E-07 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 1.20E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 4.29E-06 | 3.12E-06 | mr1146_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 3.35E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 9.20E-07 | 7.27E-10 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 3.30E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 5.87E-06 | mr1479_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 7.27E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 1.47E-07 | 1.63E-10 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 6.22E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | 2.88E-06 | 1.38E-07 | mr1918_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225207585 | NA | 6.09E-06 | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |