\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225199712:

Variant ID: vg0225199712 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25199712
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCAGTACTTGTACACCGTCAAACTAAGCTACAATAAACTAATTAATTAATTAATTAATGTACTGCACTCTTAGTCATTAATAATTGTACATTTACTGA[T/C]
GATACACAGAACGGAACTGAAACTGGCCGGCCACTGAATTTGTGTGCGCCTCATACGAGGAAATTACTGAGGCCAGTCTTCTTCCCCGTCTTCTTGACGT

Reverse complement sequence

ACGTCAAGAAGACGGGGAAGAAGACTGGCCTCAGTAATTTCCTCGTATGAGGCGCACACAAATTCAGTGGCCGGCCAGTTTCAGTTCCGTTCTGTGTATC[A/G]
TCAGTAAATGTACAATTATTAATGACTAAGAGTGCAGTACATTAATTAATTAATTAATTAGTTTATTGTAGCTTAGTTTGACGGTGTACAAGTACTGGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.80% 0.13% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 93.70% 5.90% 0.40% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 94.80% 4.60% 0.65% 0.00% NA
Tropical Japonica  504 94.60% 5.20% 0.20% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225199712 T -> C LOC_Os02g41954.1 3_prime_UTR_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:91.517; most accessible tissue: Minghui63 panicle, score: 98.877 N N N N
vg0225199712 T -> C LOC_Os02g41920.1 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:91.517; most accessible tissue: Minghui63 panicle, score: 98.877 N N N N
vg0225199712 T -> C LOC_Os02g41940.1 upstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:91.517; most accessible tissue: Minghui63 panicle, score: 98.877 N N N N
vg0225199712 T -> C LOC_Os02g41930.1 downstream_gene_variant ; 2757.0bp to feature; MODIFIER silent_mutation Average:91.517; most accessible tissue: Minghui63 panicle, score: 98.877 N N N N
vg0225199712 T -> C LOC_Os02g41954.2 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:91.517; most accessible tissue: Minghui63 panicle, score: 98.877 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225199712 T C -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225199712 NA 7.41E-09 mr1064 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 4.67E-07 4.42E-09 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 2.05E-07 3.11E-08 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 2.72E-06 7.50E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 1.22E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 2.27E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 3.28E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 7.56E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 2.41E-06 7.19E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 8.66E-06 1.23E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 8.25E-06 2.41E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 1.53E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 4.39E-08 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 8.32E-06 NA mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 7.65E-07 5.80E-09 mr1693 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 5.93E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 7.32E-08 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 6.03E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 8.10E-07 7.34E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 9.87E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 4.25E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 1.73E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 3.69E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225199712 NA 3.55E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251