\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225191431:

Variant ID: vg0225191431 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25191431
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGGATGGTGGACGTCACCCGTTTCTTGCATACCACCTAAATAATTATGAAAAAATTCTAAAAAAAAATCACAAGATAGGTTAATATGTAATATATCACTT[C/T]
ACAAACATACAAGTTAAAATTCGACTTCTATAAGTTGTAACAAAAATAACAAATCAAACTCTAACTAGTATACGTATATTCACAGTCAGATTTGTTATTT

Reverse complement sequence

AAATAACAAATCTGACTGTGAATATACGTATACTAGTTAGAGTTTGATTTGTTATTTTTGTTACAACTTATAGAAGTCGAATTTTAACTTGTATGTTTGT[G/A]
AAGTGATATATTACATATTAACCTATCTTGTGATTTTTTTTTAGAATTTTTTCATAATTATTTAGGTGGTATGCAAGAAACGGGTGACGTCCACCATCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.80% 0.04% 0.00% NA
All Indica  2759 91.30% 8.60% 0.04% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 78.10% 21.90% 0.00% 0.00% NA
Indica III  913 93.10% 6.80% 0.11% 0.00% NA
Indica Intermediate  786 90.80% 9.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225191431 C -> T LOC_Os02g41910.1 upstream_gene_variant ; 368.0bp to feature; MODIFIER silent_mutation Average:64.915; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0225191431 C -> T LOC_Os02g41930.1 upstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:64.915; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0225191431 C -> T LOC_Os02g41904.1 downstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:64.915; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0225191431 C -> T LOC_Os02g41920.1 downstream_gene_variant ; 2998.0bp to feature; MODIFIER silent_mutation Average:64.915; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N
vg0225191431 C -> T LOC_Os02g41904-LOC_Os02g41910 intergenic_region ; MODIFIER silent_mutation Average:64.915; most accessible tissue: Minghui63 panicle, score: 94.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225191431 C T -0.02 -0.02 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225191431 NA 5.75E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225191431 NA 6.73E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225191431 NA 5.96E-07 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225191431 NA 7.71E-07 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225191431 NA 1.32E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225191431 1.26E-06 NA mr1944_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251