\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225149137:

Variant ID: vg0225149137 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 25149137
Reference Allele: ATTAlternative Allele: TTT,AT,ATTT,A
Primary Allele: ATTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATATACCCTCTTTCATCGGCTTTTGCAAATTGCACTTCTATTGAAAATTCTTGTAGAAACTTTTAGAGATTTGACTTGAAAGTTTAAAGTCAACAAG[ATT/TTT,AT,ATTT,A]
TTTTTTTGATGTATTGAGATAAAATTTCTTAATTCGAAGGAATGGTTATGTGAAAGGTAAAGTTTTGAACATAAAACTTTTTTTTTAAGAAAGTTTCAAT

Reverse complement sequence

ATTGAAACTTTCTTAAAAAAAAAGTTTTATGTTCAAAACTTTACCTTTCACATAACCATTCCTTCGAATTAAGAAATTTTATCTCAATACATCAAAAAAA[AAT/AAA,AT,AAAT,T]
CTTGTTGACTTTAAACTTTCAAGTCAAATCTCTAAAAGTTTCTACAAGAATTTTCAATAGAAGTGCAATTTGCAAAAGCCGATGAAAGAGGGTATATATC

Allele Frequencies:

Populations Population SizeFrequency of ATT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 33.10% 0.99% 0.13% TTT: 13.86%; ATTT: 9.71%
All Indica  2759 19.70% 52.00% 0.80% 0.18% TTT: 14.39%; ATTT: 12.90%
All Japonica  1512 78.80% 2.20% 1.32% 0.07% TTT: 15.34%; ATTT: 2.25%
Aus  269 63.60% 12.30% 0.00% 0.00% ATTT: 21.56%; TTT: 2.60%
Indica I  595 7.10% 60.00% 1.01% 0.00% TTT: 18.32%; ATTT: 13.61%
Indica II  465 25.40% 44.70% 1.08% 0.22% TTT: 24.95%; ATTT: 3.66%
Indica III  913 23.90% 58.60% 0.44% 0.11% ATTT: 13.25%; TTT: 3.72%
Indica Intermediate  786 21.00% 42.70% 0.89% 0.38% TTT: 17.56%; ATTT: 17.43%
Temperate Japonica  767 85.50% 0.10% 1.83% 0.13% TTT: 12.13%; ATTT: 0.26%
Tropical Japonica  504 77.00% 5.80% 0.99% 0.00% TTT: 11.11%; ATTT: 5.16%
Japonica Intermediate  241 61.00% 1.70% 0.41% 0.00% TTT: 34.44%; ATTT: 2.49%
VI/Aromatic  96 50.00% 31.20% 1.04% 0.00% TTT: 13.54%; ATTT: 4.17%
Intermediate  90 46.70% 34.40% 4.44% 0.00% ATTT: 7.78%; TTT: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225149137 ATT -> A LOC_Os02g41820.1 upstream_gene_variant ; 193.0bp to feature; MODIFIER N Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> A LOC_Os02g41830.1 upstream_gene_variant ; 1313.0bp to feature; MODIFIER N Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> A LOC_Os02g41810.1 downstream_gene_variant ; 3416.0bp to feature; MODIFIER N Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> A LOC_Os02g41840.1 downstream_gene_variant ; 4061.0bp to feature; MODIFIER N Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> A LOC_Os02g41820-LOC_Os02g41830 intergenic_region ; MODIFIER N Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> DEL N N silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> ATTT LOC_Os02g41820.1 upstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> ATTT LOC_Os02g41830.1 upstream_gene_variant ; 1311.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> ATTT LOC_Os02g41810.1 downstream_gene_variant ; 3418.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> ATTT LOC_Os02g41840.1 downstream_gene_variant ; 4059.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> ATTT LOC_Os02g41820-LOC_Os02g41830 intergenic_region ; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> TTT LOC_Os02g41820.1 upstream_gene_variant ; 192.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> TTT LOC_Os02g41830.1 upstream_gene_variant ; 1314.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> TTT LOC_Os02g41810.1 downstream_gene_variant ; 3415.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> TTT LOC_Os02g41840.1 downstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> TTT LOC_Os02g41820-LOC_Os02g41830 intergenic_region ; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> AT LOC_Os02g41820.1 upstream_gene_variant ; 194.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> AT LOC_Os02g41830.1 upstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> AT LOC_Os02g41810.1 downstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> AT LOC_Os02g41840.1 downstream_gene_variant ; 4060.0bp to feature; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0225149137 ATT -> AT LOC_Os02g41820-LOC_Os02g41830 intergenic_region ; MODIFIER silent_mutation Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225149137 4.54E-06 4.54E-06 mr1191 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137 NA 2.74E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137 NA 6.19E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137 NA 2.09E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137 NA 8.53E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251