Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225149137:

Variant ID: vg0225149137 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 25149137
Reference Allele: ATT	Alternative Allele: TTT,AT,ATTT,A
Primary Allele: ATT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATATACCCTCTTTCATCGGCTTTTGCAAATTGCACTTCTATTGAAAATTCTTGTAGAAACTTTTAGAGATTTGACTTGAAAGTTTAAAGTCAACAAG[ATT/TTT,AT,ATTT,A]
TTTTTTTGATGTATTGAGATAAAATTTCTTAATTCGAAGGAATGGTTATGTGAAAGGTAAAGTTTTGAACATAAAACTTTTTTTTTAAGAAAGTTTCAAT

Reverse complement sequence

ATTGAAACTTTCTTAAAAAAAAAGTTTTATGTTCAAAACTTTACCTTTCACATAACCATTCCTTCGAATTAAGAAATTTTATCTCAATACATCAAAAAAA[AAT/AAA,AT,AAAT,T]
CTTGTTGACTTTAAACTTTCAAGTCAAATCTCTAAAAGTTTCTACAAGAATTTTCAATAGAAGTGCAATTTGCAAAAGCCGATGAAAGAGGGTATATATC

Allele Frequencies:

Populations	Population Size	Frequency of ATT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	33.10%	0.99%	0.13%	TTT: 13.86%; ATTT: 9.71%
All Indica	2759	19.70%	52.00%	0.80%	0.18%	TTT: 14.39%; ATTT: 12.90%
All Japonica	1512	78.80%	2.20%	1.32%	0.07%	TTT: 15.34%; ATTT: 2.25%
Aus	269	63.60%	12.30%	0.00%	0.00%	ATTT: 21.56%; TTT: 2.60%
Indica I	595	7.10%	60.00%	1.01%	0.00%	TTT: 18.32%; ATTT: 13.61%
Indica II	465	25.40%	44.70%	1.08%	0.22%	TTT: 24.95%; ATTT: 3.66%
Indica III	913	23.90%	58.60%	0.44%	0.11%	ATTT: 13.25%; TTT: 3.72%
Indica Intermediate	786	21.00%	42.70%	0.89%	0.38%	TTT: 17.56%; ATTT: 17.43%
Temperate Japonica	767	85.50%	0.10%	1.83%	0.13%	TTT: 12.13%; ATTT: 0.26%
Tropical Japonica	504	77.00%	5.80%	0.99%	0.00%	TTT: 11.11%; ATTT: 5.16%
Japonica Intermediate	241	61.00%	1.70%	0.41%	0.00%	TTT: 34.44%; ATTT: 2.49%
VI/Aromatic	96	50.00%	31.20%	1.04%	0.00%	TTT: 13.54%; ATTT: 4.17%
Intermediate	90	46.70%	34.40%	4.44%	0.00%	ATTT: 7.78%; TTT: 6.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225149137	ATT -> A	LOC_Os02g41820.1	upstream_gene_variant ; 193.0bp to feature; MODIFIER	N	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> A	LOC_Os02g41830.1	upstream_gene_variant ; 1313.0bp to feature; MODIFIER	N	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> A	LOC_Os02g41810.1	downstream_gene_variant ; 3416.0bp to feature; MODIFIER	N	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> A	LOC_Os02g41840.1	downstream_gene_variant ; 4061.0bp to feature; MODIFIER	N	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> A	LOC_Os02g41820-LOC_Os02g41830	intergenic_region ; MODIFIER	N	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> DEL	N	N	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> ATTT	LOC_Os02g41820.1	upstream_gene_variant ; 195.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> ATTT	LOC_Os02g41830.1	upstream_gene_variant ; 1311.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> ATTT	LOC_Os02g41810.1	downstream_gene_variant ; 3418.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> ATTT	LOC_Os02g41840.1	downstream_gene_variant ; 4059.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> ATTT	LOC_Os02g41820-LOC_Os02g41830	intergenic_region ; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> TTT	LOC_Os02g41820.1	upstream_gene_variant ; 192.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> TTT	LOC_Os02g41830.1	upstream_gene_variant ; 1314.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> TTT	LOC_Os02g41810.1	downstream_gene_variant ; 3415.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> TTT	LOC_Os02g41840.1	downstream_gene_variant ; 4062.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> TTT	LOC_Os02g41820-LOC_Os02g41830	intergenic_region ; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> AT	LOC_Os02g41820.1	upstream_gene_variant ; 194.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> AT	LOC_Os02g41830.1	upstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> AT	LOC_Os02g41810.1	downstream_gene_variant ; 3417.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> AT	LOC_Os02g41840.1	downstream_gene_variant ; 4060.0bp to feature; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0225149137	ATT -> AT	LOC_Os02g41820-LOC_Os02g41830	intergenic_region ; MODIFIER	silent_mutation	Average:43.785; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225149137	4.54E-06	4.54E-06	mr1191	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137	NA	2.74E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137	NA	6.19E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137	NA	2.09E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225149137	NA	8.53E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251