Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0225138226:

Variant ID: vg0225138226 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25138226
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTTGTTGGATTTCATTTTTTATAATTTTTAGAAGTCCCGTCAAATGATGTCACTATACACCTCTACGGCCCATCCGCCGCCTATTCTTTATTTTCATT[G/A]
GGATTCTAAAATCGAACATAACTATTGTTGAAATTTATTTTTTATTTTCTAGAAATCCCGCCAACCGTCGGCGGTCTGCAACTATACTCCTATACACCCC

Reverse complement sequence

GGGGTGTATAGGAGTATAGTTGCAGACCGCCGACGGTTGGCGGGATTTCTAGAAAATAAAAAATAAATTTCAACAATAGTTATGTTCGATTTTAGAATCC[C/T]
AATGAAAATAAAGAATAGGCGGCGGATGGGCCGTAGAGGTGTATAGTGACATCATTTGACGGGACTTCTAAAAATTATAAAAAATGAAATCCAACAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.50%	13.00%	7.43%	0.00%	NA
All Indica	2759	86.90%	4.20%	8.88%	0.00%	NA
All Japonica	1512	64.40%	29.10%	6.55%	0.00%	NA
Aus	269	95.20%	4.50%	0.37%	0.00%	NA
Indica I	595	81.70%	5.40%	12.94%	0.00%	NA
Indica II	465	96.10%	1.70%	2.15%	0.00%	NA
Indica III	913	88.50%	5.30%	6.24%	0.00%	NA
Indica Intermediate	786	83.60%	3.60%	12.85%	0.00%	NA
Temperate Japonica	767	67.00%	26.90%	6.13%	0.00%	NA
Tropical Japonica	504	63.10%	28.80%	8.13%	0.00%	NA
Japonica Intermediate	241	58.50%	36.90%	4.56%	0.00%	NA
VI/Aromatic	96	63.50%	34.40%	2.08%	0.00%	NA
Intermediate	90	78.90%	16.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225138226	G -> A	LOC_Os02g41800.1	downstream_gene_variant ; 2115.0bp to feature; MODIFIER	silent_mutation	Average:38.055; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0225138226	G -> A	LOC_Os02g41800.2	downstream_gene_variant ; 2115.0bp to feature; MODIFIER	silent_mutation	Average:38.055; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0225138226	G -> A	LOC_Os02g41800-LOC_Os02g41810	intergenic_region ; MODIFIER	silent_mutation	Average:38.055; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225138226	NA	2.37E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	6.81E-06	NA	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	NA	4.73E-06	mr1728_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	2.78E-06	NA	mr1748_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	NA	5.90E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	1.58E-06	1.58E-06	mr1783_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225138226	5.48E-06	NA	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251