Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225134433:

Variant ID: vg0225134433 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25134433
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATGCGAGGCAATGCGAGCCCGTGCGCGGCCGCCAAGGGGCGGGGCAAGGTGCGCGCGGAGGACCTCGTCGAGGCGGCGAGGCTGGCGAACGGCGGGCA[G/A]
CCGTTCGAGGTCGTGTACTACCCGCGCGCCAGCACGCCGGAGTTCTGCGTGCGCGCGGCGGCGGTCCGCGCGGCGATGCGGGTGCAGTGGTGCCCCGGGA

Reverse complement sequence

TCCCGGGGCACCACTGCACCCGCATCGCCGCGCGGACCGCCGCCGCGCGCACGCAGAACTCCGGCGTGCTGGCGCGCGGGTAGTACACGACCTCGAACGG[C/T]
TGCCCGCCGTTCGCCAGCCTCGCCGCCTCGACGAGGTCCTCCGCGCGCACCTTGCCCCGCCCCTTGGCGGCCGCGCACGGGCTCGCATTGCCTCGCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 9.80% 1.93% 0.00% NA
All Indica  2759 96.00% 3.70% 0.33% 0.00% NA
All Japonica  1512 73.70% 21.00% 5.22% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 94.60% 4.50% 0.84% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 95.00% 4.80% 0.22% 0.00% NA
Indica Intermediate  786 96.80% 2.90% 0.25% 0.00% NA
Temperate Japonica  767 74.10% 17.60% 8.34% 0.00% NA
Tropical Japonica  504 71.40% 27.60% 0.99% 0.00% NA
Japonica Intermediate  241 77.60% 18.30% 4.15% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225134433 G -> A LOC_Os02g41800.1 synonymous_variant ; p.Gln279Gln; LOW synonymous_codon Average:93.319; most accessible tissue: Zhenshan97 flower, score: 97.933 N N N N
vg0225134433 G -> A LOC_Os02g41800.2 synonymous_variant ; p.Gln279Gln; LOW synonymous_codon Average:93.319; most accessible tissue: Zhenshan97 flower, score: 97.933 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225134433 G A -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225134433 NA 1.44E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225134433 NA 1.19E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225134433 4.67E-06 NA mr1571_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225134433 9.59E-06 9.59E-06 mr1571_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225134433 2.45E-06 2.45E-06 mr1783_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225134433 4.32E-06 NA mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251