Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225072231:

Variant ID: vg0225072231 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25072231
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAATGAATCAAAAGGGAGATGGATGGTTAGAGAGAGAGAGTGTGTGTGTGTGTAACTCAAGAGCTTGACTTCGGATTCGAGAACCGAATTTTGGGAC[A/G]
TTTATTTGGTAGCAAGGAATTAGGGATGACTGGAACGTCGGTTCGGATTGTCTGAGGGATTATTGACAATAGTCGAGTGGGATTTAAGACAGAAATTCGA

Reverse complement sequence

TCGAATTTCTGTCTTAAATCCCACTCGACTATTGTCAATAATCCCTCAGACAATCCGAACCGACGTTCCAGTCATCCCTAATTCCTTGCTACCAAATAAA[T/C]
GTCCCAAAATTCGGTTCTCGAATCCGAAGTCAAGCTCTTGAGTTACACACACACACACTCTCTCTCTCTAACCATCCATCTCCCTTTTGATTCATTTCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 5.90% 3.03% 50.72% NA
All Indica  2759 12.70% 9.90% 4.46% 72.92% NA
All Japonica  1512 95.20% 0.20% 0.33% 4.23% NA
Aus  269 16.40% 0.00% 0.37% 83.27% NA
Indica I  595 11.90% 9.90% 6.39% 71.76% NA
Indica II  465 5.80% 12.90% 5.16% 76.13% NA
Indica III  913 12.90% 9.20% 2.19% 75.68% NA
Indica Intermediate  786 17.00% 9.00% 5.22% 68.70% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 88.10% 0.60% 0.60% 10.71% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 26.00% 0.00% 10.42% 63.54% NA
Intermediate  90 52.20% 3.30% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225072231 A -> G LOC_Os02g41720.1 downstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:18.358; most accessible tissue: Callus, score: 37.468 N N N N
vg0225072231 A -> G LOC_Os02g41710-LOC_Os02g41720 intergenic_region ; MODIFIER silent_mutation Average:18.358; most accessible tissue: Callus, score: 37.468 N N N N
vg0225072231 A -> DEL N N silent_mutation Average:18.358; most accessible tissue: Callus, score: 37.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225072231 NA 2.35E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.31E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 6.18E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 9.80E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 4.43E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.99E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 7.28E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.21E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 9.00E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.24E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 7.72E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 5.73E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 3.16E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.87E-19 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 5.19E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 8.93E-16 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 3.55E-08 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.36E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 5.93E-10 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 3.07E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 6.66E-09 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 2.53E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 2.44E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 1.52E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 2.14E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 2.61E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 5.82E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 2.16E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 5.01E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 2.63E-06 1.85E-09 mr1150_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 3.77E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 7.37E-06 8.98E-09 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225072231 NA 3.75E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251