Search for Variation information by Variation ID:
Detailed information for vg0225037452:
| Variant ID: vg0225037452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25037452 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
Flanking Sequence (100 bp) in Reference Genome:
GATAACTCGAGGTTAGAGCATTTATAATCTTTGTGCACCTGGTTCGTGACTAGCTCGGAGTCTCCTTTCACGATTAGTCGTTTGACCCCAAGTGCGGCTG[C/T]
AGCTCTTATCCCGGTGAGTAGTCCCTCGTATTCGACTGTGTTATTGGTCGCCCTGAAGTTGAGGTGGATTGCGTGCTTGAATTGATCTCCGGAAGGAGAC
Reverse complement sequence
GTCTCCTTCCGGAGATCAATTCAAGCACGCAATCCACCTCAACTTCAGGGCGACCAATAACACAGTCGAATACGAGGGACTACTCACCGGGATAAGAGCT[G/A]
CAGCCGCACTTGGGGTCAAACGACTAATCGTGAAAGGAGACTCCGAGCTAGTCACGAACCAGGTGCACAAAGATTATAAATGCTCTAACCTCGAGTTATC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.00% | 0.19% | 0.76% | NA |
| All Indica | 2759 | 94.80% | 3.60% | 0.33% | 1.30% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.90% | 4.30% | 0.99% | 3.83% | NA |
| Indica Intermediate | 786 | 94.50% | 5.30% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225037452 | C -> T | LOC_Os02g41696.1 | missense_variant ; p.Ala53Thr; MODERATE | nonsynonymous_codon ; A53T | Average:29.516; most accessible tissue: Callus, score: 39.341 | benign  |
0.766 |
TOLERATED | 0.06 |
| vg0225037452 | C -> DEL | LOC_Os02g41696.1 | N | frameshift_variant | Average:29.516; most accessible tissue: Callus, score: 39.341 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225037452 | NA | 8.46E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 2.97E-07 | NA | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 9.61E-07 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 8.74E-06 | NA | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 2.74E-08 | 4.23E-07 | mr1123_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 1.88E-07 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 3.05E-06 | 1.26E-06 | mr1242_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 4.78E-07 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 3.64E-06 | NA | mr1496_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | NA | 2.01E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225037452 | 1.88E-06 | NA | mr1936_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |