RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0225037452:

Variant ID: vg0225037452 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25037452
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GATAACTCGAGGTTAGAGCATTTATAATCTTTGTGCACCTGGTTCGTGACTAGCTCGGAGTCTCCTTTCACGATTAGTCGTTTGACCCCAAGTGCGGCTG[C/T]
AGCTCTTATCCCGGTGAGTAGTCCCTCGTATTCGACTGTGTTATTGGTCGCCCTGAAGTTGAGGTGGATTGCGTGCTTGAATTGATCTCCGGAAGGAGAC

Reverse complement sequence

GTCTCCTTCCGGAGATCAATTCAAGCACGCAATCCACCTCAACTTCAGGGCGACCAATAACACAGTCGAATACGAGGGACTACTCACCGGGATAAGAGCT[G/A]
CAGCCGCACTTGGGGTCAAACGACTAATCGTGAAAGGAGACTCCGAGCTAGTCACGAACCAGGTGCACAAAGATTATAAATGCTCTAACCTCGAGTTATC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	4.00%	0.19%	0.76%	NA
All Indica	2759	94.80%	3.60%	0.33%	1.30%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	90.90%	4.30%	0.99%	3.83%	NA
Indica Intermediate	786	94.50%	5.30%	0.00%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	40.60%	59.40%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225037452	C -> T	LOC_Os02g41696.1	missense_variant ; p.Ala53Thr; MODERATE	nonsynonymous_codon ; A53T	Average:29.516; most accessible tissue: Callus, score: 39.341	benign	0.766	TOLERATED	0.06
vg0225037452	C -> DEL	LOC_Os02g41696.1	N	frameshift_variant	Average:29.516; most accessible tissue: Callus, score: 39.341	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225037452	NA	8.46E-06	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	2.97E-07	NA	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	9.61E-07	NA	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	8.74E-06	NA	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	2.74E-08	4.23E-07	mr1123_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	1.88E-07	NA	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	3.05E-06	1.26E-06	mr1242_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	4.78E-07	NA	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	3.64E-06	NA	mr1496_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225037452	NA	2.01E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0225037452:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact