\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225036220:

Variant ID: vg0225036220 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25036220
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCGTTCCTCGAGTAGATTCACATCGACGTTTCGCTGCTCCTCCTGATCCTTGTCGGAATGCTTCTGTAATCGTGTACTCTGATGTCGTAGCTCACTGG[G/C]
GAGCATGGCCTCGGAGCCGTACACGAGGAAGAAGGGTGTTTCCTTGTTAGACGTTGTCGGTGTGGTGCGTACAGCCCATAGTACTGATGGGAGTTCTTCG

Reverse complement sequence

CGAAGAACTCCCATCAGTACTATGGGCTGTACGCACCACACCGACAACGTCTAACAAGGAAACACCCTTCTTCCTCGTGTACGGCTCCGAGGCCATGCTC[C/G]
CCAGTGAGCTACGACATCAGAGTACACGATTACAGAAGCATTCCGACAAGGATCAGGAGGAGCAGCGAAACGTCGATGTGAATCTACTCGAGGAACGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 10.90% 0.87% 1.74% NA
All Indica  2759 77.80% 17.80% 1.38% 2.97% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.00% 13.10% 3.36% 1.51% NA
Indica II  465 83.20% 15.70% 0.43% 0.65% NA
Indica III  913 67.40% 26.00% 0.99% 5.70% NA
Indica Intermediate  786 83.60% 13.20% 0.89% 2.29% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225036220 G -> DEL N N silent_mutation Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0225036220 G -> C LOC_Os02g41690.1 downstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0225036220 G -> C LOC_Os02g41696.1 downstream_gene_variant ; 273.0bp to feature; MODIFIER silent_mutation Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0225036220 G -> C LOC_Os02g41702.1 downstream_gene_variant ; 1935.0bp to feature; MODIFIER silent_mutation Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0225036220 G -> C LOC_Os02g41690-LOC_Os02g41696 intergenic_region ; MODIFIER silent_mutation Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225036220 NA 9.29E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 2.13E-07 NA mr1686 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 1.23E-06 1.62E-07 mr1686 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 1.26E-06 mr1744 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 4.06E-10 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 2.13E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 9.80E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 1.00E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220 NA 5.20E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251