\
| Variant ID: vg0225036220 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25036220 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )
ACTCGTTCCTCGAGTAGATTCACATCGACGTTTCGCTGCTCCTCCTGATCCTTGTCGGAATGCTTCTGTAATCGTGTACTCTGATGTCGTAGCTCACTGG[G/C]
GAGCATGGCCTCGGAGCCGTACACGAGGAAGAAGGGTGTTTCCTTGTTAGACGTTGTCGGTGTGGTGCGTACAGCCCATAGTACTGATGGGAGTTCTTCG
CGAAGAACTCCCATCAGTACTATGGGCTGTACGCACCACACCGACAACGTCTAACAAGGAAACACCCTTCTTCCTCGTGTACGGCTCCGAGGCCATGCTC[C/G]
CCAGTGAGCTACGACATCAGAGTACACGATTACAGAAGCATTCCGACAAGGATCAGGAGGAGCAGCGAAACGTCGATGTGAATCTACTCGAGGAACGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 10.90% | 0.87% | 1.74% | NA |
| All Indica | 2759 | 77.80% | 17.80% | 1.38% | 2.97% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.00% | 13.10% | 3.36% | 1.51% | NA |
| Indica II | 465 | 83.20% | 15.70% | 0.43% | 0.65% | NA |
| Indica III | 913 | 67.40% | 26.00% | 0.99% | 5.70% | NA |
| Indica Intermediate | 786 | 83.60% | 13.20% | 0.89% | 2.29% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225036220 | G -> DEL | N | N | silent_mutation | Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0225036220 | G -> C | LOC_Os02g41690.1 | downstream_gene_variant ; 1161.0bp to feature; MODIFIER | silent_mutation | Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0225036220 | G -> C | LOC_Os02g41696.1 | downstream_gene_variant ; 273.0bp to feature; MODIFIER | silent_mutation | Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0225036220 | G -> C | LOC_Os02g41702.1 | downstream_gene_variant ; 1935.0bp to feature; MODIFIER | silent_mutation | Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0225036220 | G -> C | LOC_Os02g41690-LOC_Os02g41696 | intergenic_region ; MODIFIER | silent_mutation | Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225036220 | NA | 9.29E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | 2.13E-07 | NA | mr1686 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | 1.23E-06 | 1.62E-07 | mr1686 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 1.26E-06 | mr1744 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 4.06E-10 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 2.13E-07 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 9.80E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 1.00E-08 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225036220 | NA | 5.20E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |