\
| Variant ID: vg0225012379 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 25012379 |
| Reference Allele: T | Alternative Allele: C,TGGAAACAGC |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTTTTTAGTTTCCGAAATTTTTTTTGTGTTACATCGGATGTCGGAAGGGGTTTTTGCACATAAATAAAAAAACTAATTTCATAACTCGCCTGTAAACCG[T/C,TGGAAACAGC]
GAGACGAATCTTTTGAGCCTAATTAATCCGTCCTTAGCACGTGTGTGTTTCTATAGCACTTATAGCTAATCATGGACAAATTAGGCTCAAAAGATTCATC
GATGAATCTTTTGAGCCTAATTTGTCCATGATTAGCTATAAGTGCTATAGAAACACACACGTGCTAAGGACGGATTAATTAGGCTCAAAAGATTCGTCTC[A/G,GCTGTTTCCA]
CGGTTTACAGGCGAGTTATGAAATTAGTTTTTTTATTTATGTGCAAAAACCCCTTCCGACATCCGATGTAACACAAAAAAAATTTCGGAAACTAAAAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 37.00% | 0.06% | 0.00% | TGGAAACAGC: 13.99% |
| All Indica | 2759 | 74.10% | 9.60% | 0.11% | 0.00% | TGGAAACAGC: 16.24% |
| All Japonica | 1512 | 8.70% | 90.90% | 0.00% | 0.00% | TGGAAACAGC: 0.46% |
| Aus | 269 | 16.70% | 15.20% | 0.00% | 0.00% | TGGAAACAGC: 68.03% |
| Indica I | 595 | 91.40% | 7.90% | 0.17% | 0.00% | TGGAAACAGC: 0.50% |
| Indica II | 465 | 58.90% | 3.90% | 0.00% | 0.00% | TGGAAACAGC: 37.20% |
| Indica III | 913 | 78.00% | 9.90% | 0.00% | 0.00% | TGGAAACAGC: 12.16% |
| Indica Intermediate | 786 | 65.40% | 13.90% | 0.25% | 0.00% | TGGAAACAGC: 20.48% |
| Temperate Japonica | 767 | 7.40% | 92.40% | 0.00% | 0.00% | TGGAAACAGC: 0.13% |
| Tropical Japonica | 504 | 12.30% | 87.50% | 0.00% | 0.00% | TGGAAACAGC: 0.20% |
| Japonica Intermediate | 241 | 5.00% | 92.90% | 0.00% | 0.00% | TGGAAACAGC: 2.07% |
| VI/Aromatic | 96 | 62.50% | 26.00% | 0.00% | 0.00% | TGGAAACAGC: 11.46% |
| Intermediate | 90 | 37.80% | 48.90% | 0.00% | 0.00% | TGGAAACAGC: 13.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225012379 | T -> TGGAAACAGC | LOC_Os02g41680.1 | upstream_gene_variant ; 3259.0bp to feature; MODIFIER | silent_mutation | Average:31.95; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0225012379 | T -> TGGAAACAGC | LOC_Os02g41680-LOC_Os02g41690 | intergenic_region ; MODIFIER | silent_mutation | Average:31.95; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0225012379 | T -> C | LOC_Os02g41680.1 | upstream_gene_variant ; 3258.0bp to feature; MODIFIER | silent_mutation | Average:31.95; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0225012379 | T -> C | LOC_Os02g41680-LOC_Os02g41690 | intergenic_region ; MODIFIER | silent_mutation | Average:31.95; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225012379 | NA | 8.78E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 7.47E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 1.67E-11 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 1.04E-19 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 5.89E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 2.49E-10 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 2.20E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 2.91E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | 4.33E-06 | 7.96E-16 | mr1655 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 9.89E-09 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 4.63E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 1.24E-10 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | NA | 8.99E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225012379 | 7.61E-06 | 8.22E-08 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |