\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224909167:

Variant ID: vg0224909167 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24909167
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATATATATATATATATATATATAGAGCAAGGGTGAGTATTTACGTACTCAGCAAGCCAGGGGAACTTAGGTGGTTAATGCAAGCTTCAAGGGAAGGCT[G/T,A]
TTATTTTTCAATCAGTTTTATTTGCAAGCATTTTGACAATCTAAGTGTGTTCATTCCGCGACCAGAGCGAGACAAGTCTCAGCTCGGCCGAGGGTGAGGA

Reverse complement sequence

TCCTCACCCTCGGCCGAGCTGAGACTTGTCTCGCTCTGGTCGCGGAATGAACACACTTAGATTGTCAAAATGCTTGCAAATAAAACTGATTGAAAAATAA[C/A,T]
AGCCTTCCCTTGAAGCTTGCATTAACCACCTAAGTTCCCCTGGCTTGCTGAGTACGTAAATACTCACCCTTGCTCTATATATATATATATATATATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 0.20% 1.93% 2.29% T: 0.19%
All Indica  2759 92.50% 0.20% 3.15% 3.81% T: 0.33%
All Japonica  1512 99.80% 0.00% 0.13% 0.07% NA
Aus  269 97.80% 1.50% 0.74% 0.00% NA
Indica I  595 91.60% 0.00% 4.03% 4.03% T: 0.34%
Indica II  465 92.70% 0.00% 4.09% 2.80% T: 0.43%
Indica III  913 94.30% 0.40% 1.97% 3.29% NA
Indica Intermediate  786 91.10% 0.10% 3.31% 4.83% T: 0.64%
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224909167 G -> A LOC_Os02g41530.1 upstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> A LOC_Os02g41540.1 upstream_gene_variant ; 2344.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> A LOC_Os02g41520.1 downstream_gene_variant ; 4105.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> A LOC_Os02g41530-LOC_Os02g41540 intergenic_region ; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> T LOC_Os02g41530.1 upstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> T LOC_Os02g41540.1 upstream_gene_variant ; 2344.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> T LOC_Os02g41520.1 downstream_gene_variant ; 4105.0bp to feature; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> T LOC_Os02g41530-LOC_Os02g41540 intergenic_region ; MODIFIER silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg0224909167 G -> DEL N N silent_mutation Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224909167 NA 1.14E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 5.58E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 4.74E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 1.58E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 8.20E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 7.91E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 1.42E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 1.97E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 1.64E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 1.56E-06 mr1233_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 3.36E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167 NA 2.21E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251