\
| Variant ID: vg0224909167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24909167 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATATATATATATATATATATATAGAGCAAGGGTGAGTATTTACGTACTCAGCAAGCCAGGGGAACTTAGGTGGTTAATGCAAGCTTCAAGGGAAGGCT[G/T,A]
TTATTTTTCAATCAGTTTTATTTGCAAGCATTTTGACAATCTAAGTGTGTTCATTCCGCGACCAGAGCGAGACAAGTCTCAGCTCGGCCGAGGGTGAGGA
TCCTCACCCTCGGCCGAGCTGAGACTTGTCTCGCTCTGGTCGCGGAATGAACACACTTAGATTGTCAAAATGCTTGCAAATAAAACTGATTGAAAAATAA[C/A,T]
AGCCTTCCCTTGAAGCTTGCATTAACCACCTAAGTTCCCCTGGCTTGCTGAGTACGTAAATACTCACCCTTGCTCTATATATATATATATATATATATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 0.20% | 1.93% | 2.29% | T: 0.19% |
| All Indica | 2759 | 92.50% | 0.20% | 3.15% | 3.81% | T: 0.33% |
| All Japonica | 1512 | 99.80% | 0.00% | 0.13% | 0.07% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 91.60% | 0.00% | 4.03% | 4.03% | T: 0.34% |
| Indica II | 465 | 92.70% | 0.00% | 4.09% | 2.80% | T: 0.43% |
| Indica III | 913 | 94.30% | 0.40% | 1.97% | 3.29% | NA |
| Indica Intermediate | 786 | 91.10% | 0.10% | 3.31% | 4.83% | T: 0.64% |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224909167 | G -> A | LOC_Os02g41530.1 | upstream_gene_variant ; 624.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> A | LOC_Os02g41540.1 | upstream_gene_variant ; 2344.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> A | LOC_Os02g41520.1 | downstream_gene_variant ; 4105.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> A | LOC_Os02g41530-LOC_Os02g41540 | intergenic_region ; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> T | LOC_Os02g41530.1 | upstream_gene_variant ; 624.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> T | LOC_Os02g41540.1 | upstream_gene_variant ; 2344.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> T | LOC_Os02g41520.1 | downstream_gene_variant ; 4105.0bp to feature; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> T | LOC_Os02g41530-LOC_Os02g41540 | intergenic_region ; MODIFIER | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0224909167 | G -> DEL | N | N | silent_mutation | Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224909167 | NA | 1.14E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 5.58E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 4.74E-09 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 1.58E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 8.20E-07 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 7.91E-06 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 1.42E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 1.97E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 1.64E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 1.56E-06 | mr1233_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 3.36E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224909167 | NA | 2.21E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |