\
| Variant ID: vg0224866249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24866249 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 88. )
GTCCGTTTGTTGCCCAATCAGATGAACAACTTTGACAATGGAACTGCGGTGCTCTAAGAAGTAATTTAGGCTTTCTATAATATATGTAAATTACTTTTAG[G/A]
CTTTATTGAATTTACTTTTATATGTCTAAGAAGTAATTTAGTGAAATCTAAGAAGTAATTTAGATATTTTATAAAAGTAATTTATATTTTTTCATCAAAA
TTTTGATGAAAAAATATAAATTACTTTTATAAAATATCTAAATTACTTCTTAGATTTCACTAAATTACTTCTTAGACATATAAAAGTAAATTCAATAAAG[C/T]
CTAAAAGTAATTTACATATATTATAGAAAGCCTAAATTACTTCTTAGAGCACCGCAGTTCCATTGTCAAAGTTGTTCATCTGATTGGGCAACAAACGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 2.10% | 4.59% | 10.77% | NA |
| All Indica | 2759 | 74.70% | 0.90% | 6.92% | 17.51% | NA |
| All Japonica | 1512 | 92.00% | 5.00% | 1.59% | 1.46% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 66.20% | 0.80% | 10.42% | 22.52% | NA |
| Indica II | 465 | 74.40% | 1.50% | 9.03% | 15.05% | NA |
| Indica III | 913 | 84.10% | 0.30% | 1.75% | 13.80% | NA |
| Indica Intermediate | 786 | 70.20% | 1.30% | 9.03% | 19.47% | NA |
| Temperate Japonica | 767 | 93.70% | 4.00% | 1.69% | 0.52% | NA |
| Tropical Japonica | 504 | 94.40% | 0.40% | 1.79% | 3.37% | NA |
| Japonica Intermediate | 241 | 81.30% | 17.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224866249 | G -> A | LOC_Os02g41480.1 | upstream_gene_variant ; 1450.0bp to feature; MODIFIER | silent_mutation | Average:74.69; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0224866249 | G -> A | LOC_Os02g41490.1 | downstream_gene_variant ; 522.0bp to feature; MODIFIER | silent_mutation | Average:74.69; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0224866249 | G -> A | LOC_Os02g41480-LOC_Os02g41490 | intergenic_region ; MODIFIER | silent_mutation | Average:74.69; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0224866249 | G -> DEL | N | N | silent_mutation | Average:74.69; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224866249 | 2.86E-06 | 2.86E-06 | mr1015 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |