Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224826898:

Variant ID: vg0224826898 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24826898
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTCTTGTTGGGCCTTACAGATATATCACAATAATAGACATTAGTGTTCAAAGTTATATTTCGAAGATCACTAGGTGTCCATATGAGAAGTACTCCCTC[C/T]
ATTCTAGAATATTAAGTGTTCAAAATCTATACCAAATATAAATATTTCTATAGTACAATTTCCCTACCAACCATACATCATAAGTATTTAATTCTCACCA

Reverse complement sequence

TGGTGAGAATTAAATACTTATGATGTATGGTTGGTAGGGAAATTGTACTATAGAAATATTTATATTTGGTATAGATTTTGAACACTTAATATTCTAGAAT[G/A]
GAGGGAGTACTTCTCATATGGACACCTAGTGATCTTCGAAATATAACTTTGAACACTAATGTCTATTATTGTGATATATCTGTAAGGCCCAACAAGAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.30%	0.06%	0.00%	NA
All Indica	2759	89.90%	10.00%	0.07%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	96.80%	3.20%	0.00%	0.00%	NA
Indica II	465	84.50%	15.50%	0.00%	0.00%	NA
Indica III	913	87.50%	12.40%	0.11%	0.00%	NA
Indica Intermediate	786	90.70%	9.20%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224826898	C -> T	LOC_Os02g41460.1	downstream_gene_variant ; 3643.0bp to feature; MODIFIER	silent_mutation	Average:34.4; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0224826898	C -> T	LOC_Os02g41450-LOC_Os02g41460	intergenic_region ; MODIFIER	silent_mutation	Average:34.4; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224826898	NA	3.94E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	6.58E-06	mr1284	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	3.37E-06	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	4.60E-07	1.34E-08	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	2.93E-07	2.93E-07	mr1358	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	2.82E-06	mr1428	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	8.15E-08	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	3.60E-06	3.61E-06	mr1455	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	8.05E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	8.02E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	8.01E-06	mr1635	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	6.69E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224826898	NA	3.94E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251