\
| Variant ID: vg0224826898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24826898 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 130. )
AGCTCTTGTTGGGCCTTACAGATATATCACAATAATAGACATTAGTGTTCAAAGTTATATTTCGAAGATCACTAGGTGTCCATATGAGAAGTACTCCCTC[C/T]
ATTCTAGAATATTAAGTGTTCAAAATCTATACCAAATATAAATATTTCTATAGTACAATTTCCCTACCAACCATACATCATAAGTATTTAATTCTCACCA
TGGTGAGAATTAAATACTTATGATGTATGGTTGGTAGGGAAATTGTACTATAGAAATATTTATATTTGGTATAGATTTTGAACACTTAATATTCTAGAAT[G/A]
GAGGGAGTACTTCTCATATGGACACCTAGTGATCTTCGAAATATAACTTTGAACACTAATGTCTATTATTGTGATATATCTGTAAGGCCCAACAAGAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 6.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.50% | 12.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224826898 | C -> T | LOC_Os02g41460.1 | downstream_gene_variant ; 3643.0bp to feature; MODIFIER | silent_mutation | Average:34.4; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0224826898 | C -> T | LOC_Os02g41450-LOC_Os02g41460 | intergenic_region ; MODIFIER | silent_mutation | Average:34.4; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224826898 | NA | 3.94E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 6.58E-06 | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 3.37E-06 | mr1337 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | 4.60E-07 | 1.34E-08 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | 2.93E-07 | 2.93E-07 | mr1358 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 2.82E-06 | mr1428 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 8.15E-08 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | 3.60E-06 | 3.61E-06 | mr1455 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 8.05E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 8.02E-06 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 8.01E-06 | mr1635 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 6.69E-08 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224826898 | NA | 3.94E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |