Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224820181:

Variant ID: vg0224820181 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24820181
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GGATTTTAATCCATTTTCTATTATATACTAAAGAATTCAAGCACATACCTAATGTGAATTACTAAAATACACTACCAATAGCACAAAAATTGTTTTTTCT[G/A]
GGTGGTCAAAAATACTTTTTTTTTCAAGGGAGGTGAATGATCTGCCTAAAAACAAAGGCTACCGCTTATAAAAATTGATTTTCACATGTGGACACTGAAG

Reverse complement sequence

CTTCAGTGTCCACATGTGAAAATCAATTTTTATAAGCGGTAGCCTTTGTTTTTAGGCAGATCATTCACCTCCCTTGAAAAAAAAAGTATTTTTGACCACC[C/T]
AGAAAAAACAATTTTTGTGCTATTGGTAGTGTATTTTAGTAATTCACATTAGGTATGTGCTTGAATTCTTTAGTATATAATAGAAAATGGATTAAAATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	20.40%	0.06%	0.15%	NA
All Indica	2759	70.00%	29.80%	0.07%	0.22%	NA
All Japonica	1512	98.50%	1.30%	0.07%	0.07%	NA
Aus	269	84.00%	16.00%	0.00%	0.00%	NA
Indica I	595	42.50%	57.10%	0.00%	0.34%	NA
Indica II	465	91.80%	8.00%	0.00%	0.22%	NA
Indica III	913	66.90%	32.90%	0.00%	0.22%	NA
Indica Intermediate	786	81.30%	18.30%	0.25%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.40%	0.20%	0.20%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224820181	G -> A	LOC_Os02g40950.1	upstream_gene_variant ; 4846.0bp to feature; MODIFIER	silent_mutation	Average:47.868; most accessible tissue: Callus, score: 81.954	N	N	N	N
vg0224820181	G -> A	LOC_Os02g41450.1	downstream_gene_variant ; 363.0bp to feature; MODIFIER	silent_mutation	Average:47.868; most accessible tissue: Callus, score: 81.954	N	N	N	N
vg0224820181	G -> A	LOC_Os02g41450-LOC_Os02g41460	intergenic_region ; MODIFIER	silent_mutation	Average:47.868; most accessible tissue: Callus, score: 81.954	N	N	N	N
vg0224820181	G -> DEL	N	N	silent_mutation	Average:47.868; most accessible tissue: Callus, score: 81.954	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224820181	NA	6.53E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	2.48E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	2.92E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	9.36E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	4.78E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	1.20E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	1.40E-06	NA	mr1929	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	1.77E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	8.17E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	2.01E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	2.64E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	3.69E-07	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	2.37E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	5.34E-11	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	1.14E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	1.15E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224820181	NA	1.90E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251