\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224817907:

Variant ID: vg0224817907 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24817907
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGGTACATTTGTGACCTCTCTGTTTCTCTAAAAGAATTTTTTTTAAAAAAAATCTCTACGGAACACTTTAACCCTAAGTGCCTTCGCCTCATCATCC[G/A]
CCCCGCCCTTTGACAGCTTAATATCGCCATATCGGCATGCTAGTACTGCCACCTCCCATGCACGGTCCCACCCTTGCATAGTACTCTAGCTTGCTATATT

Reverse complement sequence

AATATAGCAAGCTAGAGTACTATGCAAGGGTGGGACCGTGCATGGGAGGTGGCAGTACTAGCATGCCGATATGGCGATATTAAGCTGTCAAAGGGCGGGG[C/T]
GGATGATGAGGCGAAGGCACTTAGGGTTAAAGTGTTCCGTAGAGATTTTTTTTAAAAAAAATTCTTTTAGAGAAACAGAGAGGTCACAAATGTACCACCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.20% 0.19% 0.00% NA
All Indica  2759 88.40% 11.40% 0.22% 0.00% NA
All Japonica  1512 20.50% 79.40% 0.13% 0.00% NA
Aus  269 49.40% 50.60% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 92.70% 7.10% 0.22% 0.00% NA
Indica Intermediate  786 83.30% 16.20% 0.51% 0.00% NA
Temperate Japonica  767 17.50% 82.50% 0.00% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 52.30% 0.83% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224817907 G -> A LOC_Os02g40950.1 upstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:83.715; most accessible tissue: Minghui63 root, score: 94.134 N N N N
vg0224817907 G -> A LOC_Os02g41450.1 intron_variant ; MODIFIER silent_mutation Average:83.715; most accessible tissue: Minghui63 root, score: 94.134 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224817907 G A 0.0 0.0 0.0 -0.05 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224817907 NA 4.48E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 7.46E-11 mr1342 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 4.12E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 1.42E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 3.23E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 3.55E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 5.47E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 1.95E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 6.06E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 1.82E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 4.88E-07 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817907 NA 5.08E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251