Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224817842:

Variant ID: vg0224817842 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24817842
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAACAATCAACAATCACGTAGTGCTAGTGTGCTCCTTAACAATCCAGGATATATCTGTACGGGGGTGGTACATTTGTGACCTCTCTGTTTCTCTAAA[A/G]
GAATTTTTTTTAAAAAAAATCTCTACGGAACACTTTAACCCTAAGTGCCTTCGCCTCATCATCCGCCCCGCCCTTTGACAGCTTAATATCGCCATATCGG

Reverse complement sequence

CCGATATGGCGATATTAAGCTGTCAAAGGGCGGGGCGGATGATGAGGCGAAGGCACTTAGGGTTAAAGTGTTCCGTAGAGATTTTTTTTAAAAAAAATTC[T/C]
TTTAGAGAAACAGAGAGGTCACAAATGTACCACCCCCGTACAGATATATCCTGGATTGTTAAGGAGCACACTAGCACTACGTGATTGTTGATTGTTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.40% 0.11% 0.02% NA
All Indica  2759 93.50% 6.40% 0.07% 0.04% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 74.30% 25.30% 0.37% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 87.20% 12.60% 0.11% 0.11% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 2.08% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224817842 A -> G LOC_Os02g40950.1 upstream_gene_variant ; 2507.0bp to feature; MODIFIER silent_mutation Average:82.553; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0224817842 A -> G LOC_Os02g41450.1 intron_variant ; MODIFIER silent_mutation Average:82.553; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0224817842 A -> DEL N N silent_mutation Average:82.553; most accessible tissue: Minghui63 root, score: 95.261 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224817842 A G 0.01 -0.03 -0.01 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224817842 NA 1.58E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 7.52E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 1.71E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 7.92E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 1.73E-09 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 3.85E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 2.42E-08 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 3.20E-11 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 6.98E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 3.19E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 9.69E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 3.41E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 1.66E-08 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 6.94E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 NA 6.67E-09 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224817842 4.67E-07 4.45E-13 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251