\
| Variant ID: vg0224803179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24803179 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGGAGGAAAGGTGCATGCCTCGCTTCTAGCTCCAAGGAAGCTAGATCTGGGCAAGGTCCAGGAAGAGACTAAGGGCAAAGAGGTCAAAAAGAAATACGT[C/T]
GCTCCACAGGAGTTCCAACTAGGCATGCCATTGGTTGGAGATGACGTGCTTGCCGCAATGGGCACCGCTTGCAAGGACTTTCACTTATACTACATGGAGA
TCTCCATGTAGTATAAGTGAAAGTCCTTGCAAGCGGTGCCCATTGCGGCAAGCACGTCATCTCCAACCAATGGCATGCCTAGTTGGAACTCCTGTGGAGC[G/A]
ACGTATTTCTTTTTGACCTCTTTGCCCTTAGTCTCTTCCTGGACCTTGCCCAGATCTAGCTTCCTTGGAGCTAGAAGCGAGGCATGCACCTTTCCTCCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 0.20% | 3.81% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 0.30% | 4.28% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 0.00% | 19.33% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.50% | 0.60% | 6.88% | 0.00% | NA |
| Indica III | 913 | 92.90% | 0.40% | 6.68% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 0.10% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224803179 | C -> T | LOC_Os02g40930.1 | synonymous_variant ; p.Val427Val; LOW | synonymous_codon | Average:23.18; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224803179 | 2.68E-06 | 2.90E-14 | mr1498 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | NA | 1.47E-12 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | NA | 1.65E-08 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | 1.74E-06 | 8.29E-13 | mr1951 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | NA | 6.93E-11 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | 5.51E-06 | 1.27E-15 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | NA | 1.12E-06 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224803179 | NA | 1.55E-09 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |