\
| Variant ID: vg0224797317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24797317 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 94. )
GCTAATCACACAAATCTTGCTAGTTGCTATCAGAGGCATTCTACCACCGAAAATGCGTCACACGATCTAACGTCTGTGCGCCTTCTTCAATGCAATTGGA[T/C]
AGAAGGTTATAGATCCAGAAGATCTAGATGGGTTGCAGACCTATATTGTGAATACCCTCTGTCACCTGGAGATGTTTTTCCCACTGTCTTTCTTTGATAT
ATATCAAAGAAAGACAGTGGGAAAAACATCTCCAGGTGACAGAGGGTATTCACAATATAGGTCTGCAACCCATCTAGATCTTCTGGATCTATAACCTTCT[A/G]
TCCAATTGCATTGAAGAAGGCGCACAGACGTTAGATCGTGTGACGCATTTTCGGTGGTAGAATGCCTCTGATAGCAACTAGCAAGATTTGTGTGATTAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 43.20% | 5.88% | 0.06% | NA |
| All Indica | 2759 | 35.40% | 57.20% | 7.43% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 16.10% | 4.10% | 0.20% | NA |
| Aus | 269 | 53.20% | 44.20% | 2.60% | 0.00% | NA |
| Indica I | 595 | 22.90% | 70.90% | 6.22% | 0.00% | NA |
| Indica II | 465 | 45.60% | 46.90% | 7.53% | 0.00% | NA |
| Indica III | 913 | 28.70% | 63.10% | 8.21% | 0.00% | NA |
| Indica Intermediate | 786 | 46.70% | 45.90% | 7.38% | 0.00% | NA |
| Temperate Japonica | 767 | 82.30% | 13.20% | 4.17% | 0.39% | NA |
| Tropical Japonica | 504 | 83.30% | 15.50% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 27.00% | 9.96% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 69.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 37.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224797317 | T -> DEL | N | N | silent_mutation | Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0224797317 | T -> C | LOC_Os02g40930.1 | upstream_gene_variant ; 4035.0bp to feature; MODIFIER | silent_mutation | Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0224797317 | T -> C | LOC_Os02g40920.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224797317 | NA | 3.80E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 6.89E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 6.01E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 2.49E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | 3.41E-06 | 6.78E-07 | mr1095_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 5.68E-07 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | 7.84E-06 | 2.29E-07 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 8.21E-06 | mr1146_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 2.34E-07 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224797317 | NA | 8.72E-07 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |