Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224797317:

Variant ID: vg0224797317 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24797317
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAATCACACAAATCTTGCTAGTTGCTATCAGAGGCATTCTACCACCGAAAATGCGTCACACGATCTAACGTCTGTGCGCCTTCTTCAATGCAATTGGA[T/C]
AGAAGGTTATAGATCCAGAAGATCTAGATGGGTTGCAGACCTATATTGTGAATACCCTCTGTCACCTGGAGATGTTTTTCCCACTGTCTTTCTTTGATAT

Reverse complement sequence

ATATCAAAGAAAGACAGTGGGAAAAACATCTCCAGGTGACAGAGGGTATTCACAATATAGGTCTGCAACCCATCTAGATCTTCTGGATCTATAACCTTCT[A/G]
TCCAATTGCATTGAAGAAGGCGCACAGACGTTAGATCGTGTGACGCATTTTCGGTGGTAGAATGCCTCTGATAGCAACTAGCAAGATTTGTGTGATTAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	43.20%	5.88%	0.06%	NA
All Indica	2759	35.40%	57.20%	7.43%	0.00%	NA
All Japonica	1512	79.60%	16.10%	4.10%	0.20%	NA
Aus	269	53.20%	44.20%	2.60%	0.00%	NA
Indica I	595	22.90%	70.90%	6.22%	0.00%	NA
Indica II	465	45.60%	46.90%	7.53%	0.00%	NA
Indica III	913	28.70%	63.10%	8.21%	0.00%	NA
Indica Intermediate	786	46.70%	45.90%	7.38%	0.00%	NA
Temperate Japonica	767	82.30%	13.20%	4.17%	0.39%	NA
Tropical Japonica	504	83.30%	15.50%	1.19%	0.00%	NA
Japonica Intermediate	241	63.10%	27.00%	9.96%	0.00%	NA
VI/Aromatic	96	29.20%	69.80%	1.04%	0.00%	NA
Intermediate	90	58.90%	37.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224797317	T -> DEL	N	N	silent_mutation	Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0224797317	T -> C	LOC_Os02g40930.1	upstream_gene_variant ; 4035.0bp to feature; MODIFIER	silent_mutation	Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0224797317	T -> C	LOC_Os02g40920.1	intron_variant ; MODIFIER	silent_mutation	Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224797317	NA	3.80E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	6.89E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	6.01E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	2.49E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	3.41E-06	6.78E-07	mr1095_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	5.68E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	7.84E-06	2.29E-07	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	8.21E-06	mr1146_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	2.34E-07	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317	NA	8.72E-07	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251