\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224797317:

Variant ID: vg0224797317 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 24797317
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAATCACACAAATCTTGCTAGTTGCTATCAGAGGCATTCTACCACCGAAAATGCGTCACACGATCTAACGTCTGTGCGCCTTCTTCAATGCAATTGGA[T/C]
AGAAGGTTATAGATCCAGAAGATCTAGATGGGTTGCAGACCTATATTGTGAATACCCTCTGTCACCTGGAGATGTTTTTCCCACTGTCTTTCTTTGATAT

Reverse complement sequence

ATATCAAAGAAAGACAGTGGGAAAAACATCTCCAGGTGACAGAGGGTATTCACAATATAGGTCTGCAACCCATCTAGATCTTCTGGATCTATAACCTTCT[A/G]
TCCAATTGCATTGAAGAAGGCGCACAGACGTTAGATCGTGTGACGCATTTTCGGTGGTAGAATGCCTCTGATAGCAACTAGCAAGATTTGTGTGATTAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 43.20% 5.88% 0.06% NA
All Indica  2759 35.40% 57.20% 7.43% 0.00% NA
All Japonica  1512 79.60% 16.10% 4.10% 0.20% NA
Aus  269 53.20% 44.20% 2.60% 0.00% NA
Indica I  595 22.90% 70.90% 6.22% 0.00% NA
Indica II  465 45.60% 46.90% 7.53% 0.00% NA
Indica III  913 28.70% 63.10% 8.21% 0.00% NA
Indica Intermediate  786 46.70% 45.90% 7.38% 0.00% NA
Temperate Japonica  767 82.30% 13.20% 4.17% 0.39% NA
Tropical Japonica  504 83.30% 15.50% 1.19% 0.00% NA
Japonica Intermediate  241 63.10% 27.00% 9.96% 0.00% NA
VI/Aromatic  96 29.20% 69.80% 1.04% 0.00% NA
Intermediate  90 58.90% 37.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224797317 T -> DEL N N silent_mutation Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0224797317 T -> C LOC_Os02g40930.1 upstream_gene_variant ; 4035.0bp to feature; MODIFIER silent_mutation Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0224797317 T -> C LOC_Os02g40920.1 intron_variant ; MODIFIER silent_mutation Average:22.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224797317 NA 3.80E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 6.89E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 6.01E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 2.49E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 3.41E-06 6.78E-07 mr1095_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 5.68E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 7.84E-06 2.29E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 8.21E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 2.34E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224797317 NA 8.72E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251