Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224791922:

Variant ID: vg0224791922 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24791922
Reference Allele: C	Alternative Allele: G,CATAG
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CCAACAATAAATATGTAAATTGTCTTTTCCAGATATTCCTTTTATCTATGTATATTATTAAGATAACTTAGAAAATCATCATAGTCGTTCTAGAGGGGTA[C/G,CATAG]
AAATCTTTATTATTAAGACAACGGCTTAGTCGTCCTATATTTTTTTCTATTATAAGTTATCATAGCAATCGAAGAAAAAATCTAAGCTGTTAGATTGTGG

Reverse complement sequence

CCACAATCTAACAGCTTAGATTTTTTCTTCGATTGCTATGATAACTTATAATAGAAAAAAATATAGGACGACTAAGCCGTTGTCTTAATAATAAAGATTT[G/C,CTATG]
TACCCCTCTAGAACGACTATGATGATTTTCTAAGTTATCTTAATAATATACATAGATAAAAGGAATATCTGGAAAAGACAATTTACATATTTATTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	47.50%	0.17%	0.00%	NA
All Indica	2759	67.50%	32.30%	0.25%	0.00%	NA
All Japonica	1512	24.20%	75.70%	0.07%	0.00%	NA
Aus	269	48.30%	51.70%	0.00%	0.00%	NA
Indica I	595	79.80%	19.80%	0.34%	0.00%	NA
Indica II	465	57.40%	42.40%	0.22%	0.00%	NA
Indica III	913	73.70%	26.30%	0.00%	0.00%	NA
Indica Intermediate	786	56.90%	42.60%	0.51%	0.00%	NA
Temperate Japonica	767	24.30%	75.60%	0.13%	0.00%	NA
Tropical Japonica	504	17.30%	82.70%	0.00%	0.00%	NA
Japonica Intermediate	241	38.60%	61.40%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224791922	C -> CATAG	LOC_Os02g40910.1	upstream_gene_variant ; 1858.0bp to feature; MODIFIER	N	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0224791922	C -> CATAG	LOC_Os02g40920.1	upstream_gene_variant ; 3309.0bp to feature; MODIFIER	N	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0224791922	C -> CATAG	LOC_Os02g40910-LOC_Os02g40920	intergenic_region ; MODIFIER	N	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0224791922	C -> G	LOC_Os02g40910.1	upstream_gene_variant ; 1857.0bp to feature; MODIFIER	silent_mutation	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0224791922	C -> G	LOC_Os02g40920.1	upstream_gene_variant ; 3310.0bp to feature; MODIFIER	silent_mutation	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0224791922	C -> G	LOC_Os02g40910-LOC_Os02g40920	intergenic_region ; MODIFIER	silent_mutation	Average:45.905; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224791922	9.95E-06	9.79E-10	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.04E-09	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.08E-08	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.12E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	6.34E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.70E-08	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.32E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	9.21E-07	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	6.75E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	6.16E-09	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	9.07E-09	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.59E-07	mr1592	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	8.32E-07	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	8.24E-07	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	9.52E-08	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	5.01E-10	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.98E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	4.03E-08	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.57E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	5.17E-10	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	6.61E-09	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.99E-08	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.17E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	1.50E-06	7.64E-10	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	3.30E-06	3.51E-10	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	4.36E-06	2.14E-11	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.82E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.30E-10	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	2.49E-07	5.24E-09	mr1146_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.93E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	4.54E-08	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	6.40E-07	8.78E-13	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.33E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.27E-08	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	2.28E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.90E-11	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	3.01E-06	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	6.29E-06	mr1911_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.41E-07	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	8.94E-07	mr1929_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.37E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791922	NA	1.21E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251