\
| Variant ID: vg0224791280 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 24791280 |
| Reference Allele: C | Alternative Allele: T,CCGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTATACCGTTAGATTGTTAGGTCTT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATGACACATTAATTCCTACATACAGTTTTTTAGATAAGCATATATCTATCTATCTATCTATTATATTATTAAAACAGCCTTGAAAGAAGACACCACGTT[C/T,CCGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTATACCGTTAGATTGTTAGGTCTT]
GCTGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTACACCGTTAGATTGTTAGGTCTATATTTTAACATATGAGATTTAACATA
TATGTTAAATCTCATATGTTAAAATATAGACCTAACAATCTAACGGTGTAAATAATTCATATTTTCTCCGATTAATATGAGAATTTCTAGCCTCCACAGC[G/A,AAGACCTAACAATCTAACGGTATAAATAATTCATATTTTCTCCGATTAATATGAGAATTTCTAGCCTCCACGG]
AACGTGGTGTCTTCTTTCAAGGCTGTTTTAATAATATAATAGATAGATAGATAGATATATGCTTATCTAAAAAACTGTATGTAGGAATTAATGTGTCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 25.00% | 7.15% | 19.70% | CCGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTATACCGTTAGATTGTTAGGTCTT: 0.02% |
| All Indica | 2759 | 25.40% | 36.20% | 8.41% | 29.90% | CCGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTATACCGTTAGATTGTTAGGTCTT: 0.04% |
| All Japonica | 1512 | 90.00% | 9.30% | 0.46% | 0.26% | NA |
| Aus | 269 | 24.50% | 10.40% | 32.34% | 32.71% | NA |
| Indica I | 595 | 4.40% | 42.00% | 12.44% | 41.18% | NA |
| Indica II | 465 | 19.40% | 32.30% | 7.53% | 40.86% | NA |
| Indica III | 913 | 41.00% | 32.70% | 6.57% | 19.72% | NA |
| Indica Intermediate | 786 | 26.80% | 38.30% | 8.02% | 26.72% | CCGTGGAGGCTAGAAATTCTCATATTAATCGGAGAAAATATGAATTATTTATACCGTTAGATTGTTAGGTCTT: 0.13% |
| Temperate Japonica | 767 | 93.50% | 6.10% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 91.70% | 6.70% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 14.40% | 7.78% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224791280 | C -> T | LOC_Os02g40900.1 | upstream_gene_variant ; 4715.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> T | LOC_Os02g40910.1 | upstream_gene_variant ; 1215.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> T | LOC_Os02g40920.1 | upstream_gene_variant ; 3952.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> T | LOC_Os02g40910-LOC_Os02g40920 | intergenic_region ; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> CCGTGGAGGCTAGAAATTCTCATATTAATC GGAGAAAATATGAATTATTTATACCGTTAG ATTGTTAGGTCTT | LOC_Os02g40900.1 | upstream_gene_variant ; 4716.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> CCGTGGAGGCTAGAAATTCTCATATTAATC GGAGAAAATATGAATTATTTATACCGTTAG ATTGTTAGGTCTT | LOC_Os02g40910.1 | upstream_gene_variant ; 1216.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> CCGTGGAGGCTAGAAATTCTCATATTAATC GGAGAAAATATGAATTATTTATACCGTTAG ATTGTTAGGTCTT | LOC_Os02g40920.1 | upstream_gene_variant ; 3951.0bp to feature; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> CCGTGGAGGCTAGAAATTCTCATATTAATC GGAGAAAATATGAATTATTTATACCGTTAG ATTGTTAGGTCTT | LOC_Os02g40910-LOC_Os02g40920 | intergenic_region ; MODIFIER | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| vg0224791280 | C -> DEL | N | N | silent_mutation | Average:63.978; most accessible tissue: Callus, score: 92.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224791280 | 9.61E-07 | NA | mr1101 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 2.12E-06 | NA | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 6.50E-06 | NA | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 5.86E-06 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 9.90E-08 | NA | mr1099_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 2.18E-06 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 2.82E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 9.28E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 6.12E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 7.31E-07 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 4.30E-08 | NA | mr1123_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 3.48E-06 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 2.99E-06 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 5.50E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 2.81E-08 | NA | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 1.13E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 1.01E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 2.19E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 6.63E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 7.03E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | NA | 1.45E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 5.09E-06 | NA | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224791280 | 6.65E-06 | NA | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |