Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224791200:

Variant ID: vg0224791200 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24791200
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGACAATGATTAGTTTAGTTTACTATACTGGTACTGTATAAATTAATAAATTAATTAGTATATGTATTAAACATTGTGAAATGACACATTAATTCCTAC[A/G]
TACAGTTTTTTAGATAAGCATATATCTATCTATCTATCTATTATATTATTAAAACAGCCTTGAAAGAAGACACCACGTTCGCTGTGGAGGCTAGAAATTC

Reverse complement sequence

GAATTTCTAGCCTCCACAGCGAACGTGGTGTCTTCTTTCAAGGCTGTTTTAATAATATAATAGATAGATAGATAGATATATGCTTATCTAAAAAACTGTA[T/C]
GTAGGAATTAATGTGTCATTTCACAATGTTTAATACATATACTAATTAATTTATTAATTTATACAGTACCAGTATAGTAAACTAAACTAATCATTGTCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.40%	0.04%	0.00%	NA
All Indica	2759	93.80%	6.20%	0.04%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	84.40%	15.20%	0.37%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	91.10%	8.80%	0.11%	0.00%	NA
Indica Intermediate	786	91.10%	8.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224791200	A -> G	LOC_Os02g40900.1	upstream_gene_variant ; 4635.0bp to feature; MODIFIER	silent_mutation	Average:57.279; most accessible tissue: Callus, score: 92.456	N	N	N	N
vg0224791200	A -> G	LOC_Os02g40910.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:57.279; most accessible tissue: Callus, score: 92.456	N	N	N	N
vg0224791200	A -> G	LOC_Os02g40920.1	upstream_gene_variant ; 4032.0bp to feature; MODIFIER	silent_mutation	Average:57.279; most accessible tissue: Callus, score: 92.456	N	N	N	N
vg0224791200	A -> G	LOC_Os02g40910-LOC_Os02g40920	intergenic_region ; MODIFIER	silent_mutation	Average:57.279; most accessible tissue: Callus, score: 92.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224791200	3.38E-06	NA	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	4.52E-07	NA	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	NA	4.96E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	9.76E-06	NA	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	3.13E-07	NA	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	2.06E-07	NA	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	1.53E-07	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	6.36E-08	NA	mr1114_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	8.03E-08	NA	mr1117_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	7.20E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	6.76E-08	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	2.44E-08	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	1.17E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	1.14E-07	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	1.15E-08	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	1.31E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	NA	7.00E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	NA	5.91E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	NA	7.49E-06	mr1633_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	NA	1.47E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	7.05E-06	NA	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224791200	2.96E-07	NA	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251