Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0224707683:

Variant ID: vg0224707683 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24707683
Reference Allele: GA	Alternative Allele: AA,TA,G,GAA
Primary Allele: GA	Secondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTTCCACGCACACGTTTTTCAAACCGTTAAACGGTGTATTTTTTTTAAAAAAAGTTTCTATACGAAAGTTGCTTAAAAAATCATATTGATCTATTTTT[GA/AA,TA,G,GAA]
AAAAAAATTAGCTAATACTTAATTAATCACATACTAATGGACCGTTCTGTTTTCTGTGCGCACGTTAGAGCGAACACAGCCTTATAGGGATTAAAATGGT

Reverse complement sequence

ACCATTTTAATCCCTATAAGGCTGTGTTCGCTCTAACGTGCGCACAGAAAACAGAACGGTCCATTAGTATGTGATTAATTAAGTATTAGCTAATTTTTTT[TC/TT,TA,C,TTC]
AAAAATAGATCAATATGATTTTTTAAGCAACTTTCGTATAGAAACTTTTTTTAAAAAAAATACACCGTTTAACGGTTTGAAAAACGTGTGCGTGGAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of TA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	11.20%	3.79%	1.18%	G: 9.71%; AA: 2.37%; GAA: 0.34%
All Indica	2759	63.20%	14.10%	5.18%	0.00%	G: 13.27%; AA: 3.88%; GAA: 0.43%
All Japonica	1512	87.00%	6.90%	2.12%	3.64%	GAA: 0.13%; AA: 0.13%
Aus	269	61.70%	3.70%	0.00%	0.00%	G: 33.46%; GAA: 0.74%; AA: 0.37%
Indica I	595	90.90%	4.50%	3.87%	0.00%	G: 0.67%
Indica II	465	54.40%	21.90%	3.23%	0.00%	G: 18.71%; AA: 1.72%
Indica III	913	47.60%	18.20%	8.11%	0.00%	G: 16.10%; AA: 8.76%; GAA: 1.20%
Indica Intermediate	786	65.40%	11.80%	3.94%	0.00%	G: 16.28%; AA: 2.42%; GAA: 0.13%
Temperate Japonica	767	77.20%	12.60%	3.13%	6.91%	AA: 0.13%
Tropical Japonica	504	99.00%	0.00%	0.40%	0.20%	GAA: 0.20%; AA: 0.20%
Japonica Intermediate	241	93.40%	3.30%	2.49%	0.41%	GAA: 0.41%
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	83.30%	6.70%	3.33%	1.11%	G: 3.33%; AA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224707683	GA -> TA	LOC_Os02g40770.1	upstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> TA	LOC_Os02g40770.2	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> TA	LOC_Os02g40760-LOC_Os02g40770	intergenic_region ; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> DEL	N	N	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> G	LOC_Os02g40770.1	upstream_gene_variant ; 390.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> G	LOC_Os02g40770.2	upstream_gene_variant ; 301.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> G	LOC_Os02g40760-LOC_Os02g40770	intergenic_region ; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> GAA	LOC_Os02g40770.1	upstream_gene_variant ; 389.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> GAA	LOC_Os02g40770.2	upstream_gene_variant ; 300.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> GAA	LOC_Os02g40760-LOC_Os02g40770	intergenic_region ; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> AA	LOC_Os02g40770.1	upstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> AA	LOC_Os02g40770.2	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N
vg0224707683	GA -> AA	LOC_Os02g40760-LOC_Os02g40770	intergenic_region ; MODIFIER	silent_mutation	Average:52.491; most accessible tissue: Callus, score: 93.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224707683	NA	3.97E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224707683	3.42E-06	NA	mr1557_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251