\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224707683:

Variant ID: vg0224707683 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24707683
Reference Allele: GAAlternative Allele: AA,TA,G,GAA
Primary Allele: GASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTCCACGCACACGTTTTTCAAACCGTTAAACGGTGTATTTTTTTTAAAAAAAGTTTCTATACGAAAGTTGCTTAAAAAATCATATTGATCTATTTTT[GA/AA,TA,G,GAA]
AAAAAAATTAGCTAATACTTAATTAATCACATACTAATGGACCGTTCTGTTTTCTGTGCGCACGTTAGAGCGAACACAGCCTTATAGGGATTAAAATGGT

Reverse complement sequence

ACCATTTTAATCCCTATAAGGCTGTGTTCGCTCTAACGTGCGCACAGAAAACAGAACGGTCCATTAGTATGTGATTAATTAAGTATTAGCTAATTTTTTT[TC/TT,TA,C,TTC]
AAAAATAGATCAATATGATTTTTTAAGCAACTTTCGTATAGAAACTTTTTTTAAAAAAAATACACCGTTTAACGGTTTGAAAAACGTGTGCGTGGAAAAC

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 11.20% 3.79% 1.18% G: 9.71%; AA: 2.37%; GAA: 0.34%
All Indica  2759 63.20% 14.10% 5.18% 0.00% G: 13.27%; AA: 3.88%; GAA: 0.43%
All Japonica  1512 87.00% 6.90% 2.12% 3.64% GAA: 0.13%; AA: 0.13%
Aus  269 61.70% 3.70% 0.00% 0.00% G: 33.46%; GAA: 0.74%; AA: 0.37%
Indica I  595 90.90% 4.50% 3.87% 0.00% G: 0.67%
Indica II  465 54.40% 21.90% 3.23% 0.00% G: 18.71%; AA: 1.72%
Indica III  913 47.60% 18.20% 8.11% 0.00% G: 16.10%; AA: 8.76%; GAA: 1.20%
Indica Intermediate  786 65.40% 11.80% 3.94% 0.00% G: 16.28%; AA: 2.42%; GAA: 0.13%
Temperate Japonica  767 77.20% 12.60% 3.13% 6.91% AA: 0.13%
Tropical Japonica  504 99.00% 0.00% 0.40% 0.20% GAA: 0.20%; AA: 0.20%
Japonica Intermediate  241 93.40% 3.30% 2.49% 0.41% GAA: 0.41%
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 83.30% 6.70% 3.33% 1.11% G: 3.33%; AA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224707683 GA -> TA LOC_Os02g40770.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> TA LOC_Os02g40770.2 upstream_gene_variant ; 302.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> TA LOC_Os02g40760-LOC_Os02g40770 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> DEL N N silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> G LOC_Os02g40770.1 upstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> G LOC_Os02g40770.2 upstream_gene_variant ; 301.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> G LOC_Os02g40760-LOC_Os02g40770 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> GAA LOC_Os02g40770.1 upstream_gene_variant ; 389.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> GAA LOC_Os02g40770.2 upstream_gene_variant ; 300.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> GAA LOC_Os02g40760-LOC_Os02g40770 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> AA LOC_Os02g40770.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> AA LOC_Os02g40770.2 upstream_gene_variant ; 302.0bp to feature; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N
vg0224707683 GA -> AA LOC_Os02g40760-LOC_Os02g40770 intergenic_region ; MODIFIER silent_mutation Average:52.491; most accessible tissue: Callus, score: 93.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224707683 NA 3.97E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224707683 3.42E-06 NA mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251