| Variant ID: vg0224690328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24690328 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAACAAGTGCTTCACTATAGACAAATATAGAGGAGGACGAAATGTACAAACAGTCGTTTTTACTTTTTAAAAGAAAGTACAAACCACTGTATTGCGACT[C/T]
AGGCGTTGTTTAGATCCCAGAAAATTTTAGCCAAAAATATCACATCAAATGTTTGGACACATGCATAAGGCATTAAATATGGGATTGCGAGACAAATCTT
AAGATTTGTCTCGCAATCCCATATTTAATGCCTTATGCATGTGTCCAAACATTTGATGTGATATTTTTGGCTAAAATTTTCTGGGATCTAAACAACGCCT[G/A]
AGTCGCAATACAGTGGTTTGTACTTTCTTTTAAAAAGTAAAAACGACTGTTTGTACATTTCGTCCTCCTCTATATTTGTCTATAGTGAAGCACTTGTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 11.60% | 23.17% | 23.49% | NA |
| All Indica | 2759 | 30.00% | 2.40% | 32.73% | 34.87% | NA |
| All Japonica | 1512 | 64.60% | 30.30% | 1.52% | 3.64% | NA |
| Aus | 269 | 14.50% | 0.40% | 55.76% | 29.37% | NA |
| Indica I | 595 | 9.60% | 1.20% | 31.93% | 57.31% | NA |
| Indica II | 465 | 20.90% | 0.20% | 36.13% | 42.80% | NA |
| Indica III | 913 | 49.40% | 1.50% | 30.89% | 18.18% | NA |
| Indica Intermediate | 786 | 28.50% | 5.50% | 33.46% | 32.57% | NA |
| Temperate Japonica | 767 | 49.40% | 45.20% | 1.43% | 3.91% | NA |
| Tropical Japonica | 504 | 83.30% | 10.10% | 2.18% | 4.37% | NA |
| Japonica Intermediate | 241 | 73.40% | 24.90% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 80.20% | 8.30% | 7.29% | 4.17% | NA |
| Intermediate | 90 | 60.00% | 15.60% | 13.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224690328 | C -> T | LOC_Os02g40720.1 | upstream_gene_variant ; 2748.0bp to feature; MODIFIER | silent_mutation | Average:35.385; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0224690328 | C -> T | LOC_Os02g40730.1 | upstream_gene_variant ; 556.0bp to feature; MODIFIER | silent_mutation | Average:35.385; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0224690328 | C -> T | LOC_Os02g40720-LOC_Os02g40730 | intergenic_region ; MODIFIER | silent_mutation | Average:35.385; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0224690328 | C -> DEL | N | N | silent_mutation | Average:35.385; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224690328 | NA | 2.21E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224690328 | NA | 3.01E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224690328 | NA | 4.29E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224690328 | 4.18E-06 | 8.26E-13 | mr1770_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |