\
| Variant ID: vg0224678499 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 24678499 |
| Reference Allele: CCA | Alternative Allele: TCA,C |
| Primary Allele: CCA | Secondary Allele: TCA |
Inferred Ancestral Allele : CCA (evidence from allele frequency in Oryza rufipogon: CCA: 0.99, CACA: 0.01, others allele: 0.00, population size: 82. )
CACTATGTCCCACAAAAAAATGAATCTAAAACTGGATGTGACATATTATAGTACAACGAATCTGGACAAATATATCACATTCAGTACTACTCCCTCCGTC[CCA/TCA,C]
AAAAAAAGACAAACCCTAGGTTTCCGTGTCCAACTTTAACTGTCCGTCTTATATAAATTTTTTTTATAATTCGTATTTTCATTGTTGTTAGATGATAAAA
TTTTATCATCTAACAACAATGAAAATACGAATTATAAAAAAAATTTATATAAGACGGACAGTTAAAGTTGGACACGGAAACCTAGGGTTTGTCTTTTTTT[TGG/TGA,G]
GACGGAGGGAGTAGTACTGAATGTGATATATTTGTCCAGATTCGTTGTACTATAATATGTCACATCCAGTTTTAGATTCATTTTTTTGTGGGACATAGTG
| Populations | Population Size | Frequency of CCA(primary allele) | Frequency of TCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 15.90% | 10.07% | 30.30% | C: 0.06% |
| All Indica | 2759 | 21.60% | 17.90% | 15.69% | 44.73% | C: 0.04% |
| All Japonica | 1512 | 81.40% | 15.70% | 0.33% | 2.51% | NA |
| Aus | 269 | 41.30% | 0.40% | 12.64% | 45.72% | NA |
| Indica I | 595 | 9.40% | 14.60% | 23.53% | 52.44% | NA |
| Indica II | 465 | 16.30% | 10.30% | 4.73% | 68.60% | NA |
| Indica III | 913 | 28.10% | 23.00% | 20.04% | 28.81% | NA |
| Indica Intermediate | 786 | 26.30% | 19.10% | 11.20% | 43.26% | C: 0.13% |
| Temperate Japonica | 767 | 93.60% | 5.70% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 62.30% | 34.10% | 0.79% | 2.78% | NA |
| Japonica Intermediate | 241 | 82.60% | 9.10% | 0.00% | 8.30% | NA |
| VI/Aromatic | 96 | 72.90% | 4.20% | 3.12% | 19.79% | NA |
| Intermediate | 90 | 62.20% | 14.40% | 1.11% | 20.00% | C: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224678499 | CCA -> TCA | LOC_Os02g40700.1 | downstream_gene_variant ; 1135.0bp to feature; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> TCA | LOC_Os02g40700-LOC_Os02g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> DEL | N | N | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> C | LOC_Os02g40700.1 | downstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> C | LOC_Os02g40700-LOC_Os02g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224678499 | NA | 1.99E-08 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.66E-09 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 8.96E-08 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.02E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 4.97E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.25E-07 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.44E-06 | 1.84E-08 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.31E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.43E-06 | NA | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.85E-06 | mr1146 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 9.03E-06 | NA | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.94E-08 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.85E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 9.04E-11 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 4.77E-09 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 8.61E-09 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.43E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.86E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 3.90E-06 | NA | mr1858 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.07E-06 | mr1858 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 3.78E-06 | NA | mr1859 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.21E-06 | mr1859 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 8.42E-09 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 8.69E-06 | 2.16E-08 | mr1868 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 9.09E-07 | mr1911 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 4.18E-06 | NA | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 7.09E-06 | 8.66E-10 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 7.90E-08 | 1.12E-13 | mr1929 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.20E-07 | 6.85E-10 | mr1929 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.12E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 5.23E-07 | 2.62E-07 | mr1020_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.94E-09 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.68E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.20E-09 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 4.21E-06 | NA | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 1.14E-07 | 1.09E-10 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.26E-08 | 3.65E-11 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 4.88E-07 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 4.17E-09 | 2.36E-13 | mr1099_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 6.06E-06 | 5.75E-08 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 1.16E-08 | 5.26E-14 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 3.05E-06 | NA | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 3.02E-07 | 1.89E-08 | mr1146_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.72E-07 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.42E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 8.68E-07 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 1.12E-08 | 5.71E-13 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 4.50E-07 | 1.15E-08 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.66E-07 | 2.91E-10 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 6.11E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.40E-06 | mr1355_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.07E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.69E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 4.56E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.56E-07 | mr1509_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.28E-07 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.12E-07 | mr1712_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 9.00E-06 | mr1719_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 4.95E-06 | mr1719_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 2.87E-12 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 1.16E-06 | 7.66E-10 | mr1895_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 7.74E-07 | mr1911_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 6.67E-06 | 3.13E-08 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 3.48E-06 | 1.50E-09 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.59E-06 | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 9.03E-06 | 4.67E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.71E-11 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |